SelenoDB
Release 2.0
Chart Advanced
Transcript Report for SPT00002973_2.0
Identity
TranscriptIodothyronine deiodinase 2 (DIO2)
SpeciesHomo sapiens neanderthalensis (Neandertal)
Transcript IDSPT00002973
Transcript release2.0
External ID None
Gene SPG00002836_2.0
Annotation
Prediction method(s)
Curated external database annotation (Ensembl, 38) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Full length Spliced 5UTR CDS 3UTR
Forward Reverse  
SNP (Neandertals) SNP (Present-day Humans) Fixed differences to present-day humans
Sequence
>SPT00002973_2.0 # Transcript # Iodothyronine deiodinase 2 (DIO2) # Neandertal 
TACTCAGCCCAATGCCATTTGAGTAGTGAAAGAAGTATGGAGCTGTTAGAGATTCATGTT
CTTCCGATAGATAAACTCCTGTCTTTCAGTAAGCCAATAGGGCTCTGTTGAAATATGGAT
TCAGTTCTTAATTTCCTTGCCTTTATATAACTTTTTAAAACAATAAGCTCTCTTATAATC
ATACCTTTAACCAGCTAATCTAGTTTTCTTTCATCTCTTGCTGAAATTCTTCTCCAGCCA
ATGCCGGACTTCTTGAAGGTTGTAGGAGAAGGGGCCCTTTCCTCCCAGATAAGCAATTTT
CTGTCTCTGCACAATGCACACACGTTCAAAGGCTACCCCGTAAGCTATGTTGGCGTTATT
GTCCATGCGGTCAGCCACAACTCGGCACTGGGGCGGCAAGGAGAAACGCTCCAGAAGCTG
CTGGGCTGCTGCACATCGATCTTCCTGGTTCTGGTGCTTCTTCACCTCAAAAGACAAAGA
GGAGTCCCCCGGTATCGCCCAGCCATCTGATGGATGAGCCTCATCAATGTAGACCAGCAG
GAAGTCAGCCACTGAGGAGAACTCTTCCACCAGTTTGCGGAAGGCTGGCAGCTGGCTCGT
GAAAGGAGGTCAAGTGGCTGAGCCAAAGTTGACCACTAGTGGGCGCTCAGGGCTGGCAAA
GTCAAGAAGGTGGCATGTGGCTCCCTCAGCTATCTTCTCCTGGGTACCATTGCCACTGTT
GTCACCTCCTTCTGCACTGGAGACATGCACCACACTGGAATTGGGGGCATCCTCACCCAA
TTTCACCTGACGGTAAAAAAAAAAAAAAAgAAGAAGAAGAAGAAGGTGAGAATATCACAT
TAAACACATTGCCACTTGAATTCACATTAAATAGTTACAATTGGCTCTAATAGAGTGTGG
TATTTCCTTCAGAGCATTTGGTAAACATTTATTGATTTGAGTAAAGAGGCATGATGGCAG
GTAATGTAAAGAATGGCCCAAAAGACAATAAAAGTCTTTTTCATTCTGTATAGTCACTGA
AGATAATTATTTTCATCACTGAAGGCACTGGAGTTAACTCTTTTTAAAATTAAGCCAAGG
CTGGTATTCTTTACTATCCTTATTTTGCTGTCAATTCTTAACATGCATTCTATAACAAAT
GATTAATTGACTTCATTTTAAAAATTAGAAGCAAATGGTCTACTTTAAGACAAATTATCA
GGGTCTTGGGACATGGTCCCTCTTTCTGAATTCTGAAACACCAGGCAGGACCTTCATTTT
CTTGCATGATACTAAGTCATTTAATCTCAACCAATGGCCAGTGATACCAGTGGGCTCTAT
TCTTGGCCAGATCTAGAAAACCTGAGGTCTACCACTTATAAGAAGTGTTACTTCCACTTA
ACCTCTTTAGTGATTCAGCTTTCCCACCTGTAAAATGGAAATAATAATGCCTGTCTTCCA
CATATGGCAACTGGAGGACAACATGAGAAAAAGAGCTCTTTGTGCACTGTAACTCTATGG
GTGTGTGTTGTCCTTATCAGATGCTACCCCACCATGTGAAACAGAACATCATCATTCTTG
GGCAATTCTGTGTTTGTTTTTGTTTTTTTAAATGCCCTGAGCAAAGCTTTGCACTCTCCT
CAATATGGCATCCTCCCTGGAGGCTTCTACTGCCACTGCTTACAAGGTGGTTCTTACCAC
TCCAATCTTACAATTTCCATTTAAAAAAAAAATAAAAACAGACAAAAAAACAAAAATGGT
TACTCCAGAATTCTACTTTAAGTCAATTTCTCATTTTCCATGTGTGCTTGTTTCCTTCTT
TTTATCTAGGAAGTCACATTAAAAAGTACTTTTCTACCCCACAATTTGTTAACAAGCTCC
TCTGAATTATAAAATATTGGGGCAGAAGAGGTAGAGATAAAAATTGTTTCATGTGCTCCC
TTTGCACATGGTTTAAATAGTTGAGAACAGAATGAAGGAAAGTTTGCAGCCTTTGAATCT
GTAAATTGATCATAAAAAGCAGGCAACAATAAAAGAGCCAATTACTTCAGTTTGAATTAA
TACGATTGGATCTTCCTTAGAATGGTTTAATCAAAGCCAATAACATTAGGGACAATTTAG
GGACAGTACAATTGATTTTTATATACTATCCTTAATATTACAATATACTTCCAACTGGGT
TGACTTATTTCCCTCATATACATACAGCCACACATAATGCTACTGTTAATTGAAGTCACT
TCGAAGTGAATTGTTAAAGATGTAACAATCCAAACTGATATAACCCACTCAAGGGCTTTT
ATTCAGAAGCTTCTATCTAATGTTAATGCATAACTCATTTTAACTGTAGAGAAAGAATTA
AAGTTCTTTCTCTCCCTTCTGAAAAATCCTAGCAGGGAAGGTTTGAAATAAGCATTATTA
GTGTTCTAAGAGAAATCTTACTGTAATAATCTTCCTTCTCAGAAAGGAAGCTGCTGGTGT
GATTTAAGTAAGTACATTTGTTTTTTAGTCACCACCACAGAGAAAATTATTTTACTTATA
CTAACTTTCTTGATTAATTTGCAAATGACACTAGATGGAGAAATCTAATAAGCACATTTA
GCTGGATTCTTTCATATGAACTACCCTAGTCTTTAAGGCATGAAAATATACATCAAATTT
AAAGATATGTTGAAGGTATTATTAACCTTTTAAGCCGTGAGTTCTTTTTGTACTTCTTTT
TTTTTTATAGATCTAGGTAGTGGGTAGCAGTCTCTTCTCTTTAGATCTTTCCCATTTGAA
ATAATAGTAATGATTCTAGAAGGGGTGTTTTAACAATATCATGTGTACTGTGTGCCTCAA
CGTACCGTGATAAGAAGACCTAAATGCATTCAGATTAGTCCGTTGTAGGGACTTCCTGTT
AAGTAAGCAACCTGTACACTTGTAGGTTCTTGATAGGTAAAAACATTCATCTGCATTTTG
GAATCATTTTTGAAACCCATGAACAATTATGTGGCCTTGACAAATGCGCCTCTAACCCCC
TGATTCATCCGAGCAGACCTGTTGATCCTTTCATTATGTCTGATTATTCAACTGAATAAT
CTAATCTGTTGCTTTAGTCACAGGGGACTCTCTTATTACCTGCAGTAAATTTTCTTGGAA
AGTTAAGGCACCTTCTCCTTCTTAGAAACAATGTATAGTTCAGCTGCAGAATTCTTTCCA
AAACACAGACTAATTTGCCTTGGGAAATTTAGAGTAAGTACAACACTGTCAGTCTAAAAT
AAAAAAATTAGGAAAGTTACCAAATTCGTAATGCTCTTTATGGGGGGGATTTAGCATTTT
GTTAGGATTAGGgTTAGACTGGGAAGTATTTATTTTATTGAATGAATGCTAGTTGTTATA
ATCCTAGGTCAGTGAAGAATTTTACACTTAATGATAACCCTGACCTGCAATGAACATAAT
CATATTTGGGTGATGGATAAGCTCACTGAGGCAGATAAATTTAGAAATATGAATCCTGGG
GCCCTCTCATAGAGTACTACCAAAATCAGCACTCAATGTTATTGATCTGTCCTTGACAGT
CTCATCTGGTCAGTGCACAAAACAAATGTGGCCTATTATTTTTATTTTGTTGAGGAGCCA
GGGTCCCTTACTGAATGTTATAATGTCATAAATGGATATGCTTATTCATGAAGGTGCCTA
GGCAAGAGAAAATGCATAGATAAAATTAATATTATTAATAAAACTAAGAAGGAAAAACAC
ACACCCACCATCCATAAATCCAAATGTGAGTAGACCAGTAGTCTGCTTTTATAAGCTTCA
TATACTAGTCATAAAATGTGTCCATCTTTGCTAAAACCTGATGGAGGACAATTTAGCTAA
AATAAAGAAAAAAAACTTTTTTTAGATATGGAAGTTTCCTTTAACCTAAAAGAAAATATT
CTAAAAGGATATTACTGTTCATTCTCATCTCCCCATTTGGTCACCATAAAAATTAAATTC
CTAATAGACCAGAGTTTCAAATGGAGAACTTCTTGGTTTGCTGGGTTATGCACCCTGCTG
AGACAGGCTGGGAGAATCACCATTGTCTTCGATGATGGAAGATTCTTTGCTCTCCCCACG
AGCAAAGCATTCCTTGACACAGAGCCAAAATGATGAAGAAAATAAAGTTGGTCCCATAAT
AACATTTAGGCTGCAGGAAAGAAGCTCAACAAAAACAAGTTATCCCCTGGTACTCCCAAA
CTTTGTTTTAATTTCCCACAGTGGCACAGAAAGTCTGGCCACAAGTTACCTATCATCTTA
ATTTCTCCTTCTTAGAGGGTTTGTGTTTGGTTTTTGTCCTTAATGAGACATATTTGCCAA
AGAGGCATTCAAAAGGCATTTTTTACTCTTGCGGAAGAGTAATTAGGTCGGTACCTCTTT
CCCTGCCAGCATTAGCCGCTCTAAAGAGAACCCTGCCCAGTATTTAATGCCCAAACACAA
GAAGCATCATTTCCACTAATTGGTCTTGAAGTTCCGATGTTCCCAAAGGGTCCCTTTATT
TTGCAAGGATCAGAAAGGACATACGTAAAATGTGATATTGTCATCGCTGACTTTTATCTC
TCTCATCTGCACTATTACAGTGGTCCTCTCTTATGTTTTTGCAAGCAACATCAACACAAC
ACCAACAAAGGAGGTAAATAAAGGATTTGCATTTTTACAACAGAAGACATCTCCGGGCCA
AGTTCAAATGTTGGAATGGAAATCTTTATAAATATGAACATGAACATAAACATATAGCAT
ATATAAAAATTTGATTCCCTTGATGATGTTCAGTGTTCAGTGCATGGGGAAAAAGGAAAT
GCTGCTTTAGCATGTGGACTGTGAAATGCAGGGCAAGGGGGAGAAAAGAACCATTCATCA
AGTAGAAGCAGAAAATACAGCATATACTACTAACCTTGTTTCTTGTTTTGGGATTTTATT
TCTTTTTCTTTTCCACAGCCTGAGAAAGCCTTGTGGACAATATATCACATAATCTCATAA
CAGAAACTAAAGCAAATTATAAAAATGAAGGGTGGGTGTGTGGTAGCAGAATTTTCACAC
ATACTACTTGCTATCCAAAGCCCTGAAAATGGCTTTATTAACTATCAGGAAGTTTCAAAT
TCTTTGACATAATGACCAGGCTACATCAATGTCCTTAGAAACATGGCCAAACTATCATTA
AGAAGAGATTTAACCATTTATATTCAGATTGGCCAAATAAATCAGAGTTGAAGAATAGGC
TACGTACTCCTTCCTCTGAGCTCAATTCCCTTTTAGCTATTCTCTTTTTAATTTGTACCT
TGAAAATGTAGCTCTAAGCTCTATCATTCCCCAATGTTTTATCCAAGTGATGGACAAGCT
CTGGCTGTGGCCTGCTTTGTGTTCTTTTGGGACTGTTTCTCTCTTAAAAGGGCCATTTTC
CATTGTGGAAACTAGTGTCAAAGGCTTGAGGTGAATGAAGAGGAGGAGGAGAATGTTAAA
GAGACCCTTTCAAAACCAAAATTATATGTTCAAATGAATATGTTTTCTGTACCTCTGCAA
TATTAACCGTGCAGAAGCTAAACTGCCTGTCAGCATCTATACTGTGTGTTTACTTTTACA
CTTCATTTAGGTAAGAGCCAGGCTCCCAGACAGAGCAATTTGCTTATTGGTTGCATGTTT
TTAGTCTCTGAGCGCCAGCACAAGGATATACTGTTCAGATGCAATGACACTGACTAAAGA
AACTTAAATAACAAACACCTTTTATTCACCTCAGGGTCTCTCACCAGTGTCTATAGACTT
TCCTTTCAATCAAAATTGTACACAGAATCCATCTCTTACTAAACTCACATTATCTTTAAA
GGCTTCTCCATAAAGTTAATTCAAATCCCTTTCAACCTTTTAAGAAAGGGTTTATTTAAA
AAAAAAAGAAAAGAAAATATTTCGTTCTTTCTTTATTTCTGTGTTGCCCCTTGTGGAGGC
AAAACACAGGGATAATACTTTTACTCCACTTTCTCTACATATCTTTCCAGGCATCTGACA
TGCAGCAACAAGGAGAATTAATAACAGTAAATCACATGTGTAGTTGTATCACATGAGCAC
ACACCCCTCTCATCCTGGAAAACTTCACTTCTGGGGATGGGTAGCCTCAAAATAATGCAA
GTCAGGGTTATGAAATAGTGTGATGCCATCTCAAACAGAACCTCTTACAACGTCTCTGGA
AATGACTACACCCAAAGACAGTGGCACAAATGACAAGAGCATTCAGAGAAGTGATTCAAC
CTGGTTGAGAGATTCTGAGTGACCCTCAAATGCCACCACAGAAACCACCACCCTTGCCAT
ACTTGAAGACAGAAAAGAGACCATCATTCAGTTGCAGCTGTGTTCATAATGTTTCCATTT
ATCACACACCCAGTCCAGTCTTGTTTCTGGATATGTGGGTCCTGGGGTTGCTTCTGCACA
TGGTAGCTATTACATAAATCATCAAAAGCAAACATAATAACATCAGTCGTGAACTTGGTC
ACTAATCAAATCAGTAGGCAGGGACAAAGAAATACAGAATAGGAATATACAAACCATATG
CAAAAAGAAAAAACAAATCACTCATCCTTCCCAATTTCCTAGAATAGGAATAACAACATA
TTGCAACATAATGGAACACTATACATTGGTGAAAAAAACAATAAACTTTATTGAAGACGT
ATTTGTTTGCTTTTCCATTTTATGTTCAATAAGCTGCTTAATGGGAGAAACAACCTCACT
TAATATTTGTGGGTAACATTACAGCCCCCATTGTTTATATGAGAGATGACTGTTTTTCAT
GTTTTTCTTAATGAAACATGACATTTATATAAGAAATATATGTATATAAGTAAAATTCTT
CCAATAAGTTTTTTTTTTTTTACTTTATAGGCAAAAGGCAATTGTCCTTCCAAAAAGTAA
GAGTTTAATATACTGAGATCAAATCACTGATATTTCCATGGTATCTGCTAACACGTATAA
AATATGATGTTGAAGAGGGAACTTCCTAATTAATAATATGTCTGATATACTTGTGTACTC
CTCCACCTGCCTCCAAATTGCCTTCCACTAAAACAAACCATTAAAAACTTCCCATTCAAT
GTATACTTTTGTGGAAATGAAATAATCAATTCAATATCTACTTTTCTAGATCTCCCGTCC
TCACTGACATGCACAATATAAATGAGTTTTTACTGTTAGAACTTTGAGCACCAATTCATA
TTCTCATAAAAGAATTTCCATCTACTAATAAGAGCTCTTACTATTCACATTTTTAACAAC
AATAAACACAAACCCTCTTTGGGTTACTATCAATAATAAAGACGTGCATTGTGGTAAAAT
TTCCCTAGTTCACAACAGATATTTTCTTCTTGAACATCTGATTTTCAGAAGAACAATCCT
GTCCTGAATTCTTTGTAATTTTACAAGTTACTTCTTCTCTTTTCTTGGCGCATGGTTTTA
GTTTTCTAGTGTTTATTTATGGAGGATGCATTCCCTTGCGTCTCTATTATTTCGAGTTCC
CCGTCTCTGGTTCTAAGGTGCTGCCTGCCTAAAACACACCACTTCACTGAACACCTGGCT
TCTATATTCCTCTAAAATACAGATGTACAGTTGCTTTTTCTGGCATCTTGGGCAAGGTCC
CACAACACTTTTAGGGAAACCAAGATTGTCTATTTTGATAACTACTTTTGCCAAAATAGT
TCATTCTTCTCAAGCCTGGTTGAGGGGGTGGAGGGGACCTTTAGAAGTCATATGGGCATA
GCAGGTGGGGGAAAACTGACAAAAGACCAGGGCGAAAATCATCCTCTGTGCCCCTGAAGA
TCTTAGTTGAAAATGCTCTACTAACATCTCTCACCAGCAAAAAGCCTGGAACACAGTATT
TTTCACTTAGAAACTAAGATCACTACCTCTGATTTTGAGAGAGCAGCCCCTGGGCACTAC
CTGAGCAGGTAAGGGAGACCACTGCTCTAATGCTCATAACAGCTCTGAGATTTAATGAAT
CACAGACCCATCATCTCTTTCTAGGGCAACGTATTTTATTTTTGAGAAACAAAGTAAAGG
AGGCTTCCCTTACAAATGCTGGATTTCTGACAGCTAGTTTTCAGACTTTTCTTTCGCAAG
TTGATATCTAGTAACTCAGGATCACTGCCTGAAAATCGCTTCCAAAGGGTTCAAATTTGA
ATCAATGTAGAGGAGGTGGCACACAGCTGCTTGCTTTCATTAACTCTTACCTCTACCAGA
AACCAAGCAGCTATGATGCCCAATCACAATTTCTATGACCACTTTCTTATCTTGTCAACT
CTCTGAGAGTTCTGAGTAGCATTTCTCATTTCTTGCTTTTCAGTACCCACCCCTCGAACA
TACTTCCTCAGTGTACCTCAGCCTCCCATCAAGCAAAAAATCAAAATTCCAGTTTATGGC
AAGAGCAGAATAAATGCAGCAGTCTCCTCTTCTCCATCATTTTCTGACTTTTCCCAAGTT
ATCGTACCAGCACAATGCCTTCTACTCCCAAATCACAGCAAGATATTAATAACCCTTAGT
AGAAAGATTCCTTATTAGGTCACACAGAGTCATTATGGCTTAATAGCTGTCACCCTCCCA
AGCTAACCTGTGCAACAGGTGTGGAAAGTAAACTTAGAGGCTCACTTGGCAACCCCACAA
ATAGGGCTTCACAGCTCTCCCCCCAATGCTCCCAATGGCCTCTGGTCCCCAGCATATGAG
CCCCTGCCCCTGTAGACCTAGGGAGAAGCCCTTCTCAGCTCAGCTCACCTGTTTGTAGGC
ATCGAGGAGGAAGCTCTTCCAGACGCAGCGCAGTCCCTCTGAGGTCAGCATG
Chart Advanced