SelenoDB
Release 2.0
Chart Advanced
Transcript Report for SPT00001764_2.0
Identity
TranscriptSelenoprotein M (SELENOM)
SpeciesOchotona princeps (Pika)
Transcript IDSPT00001764
Transcript release2.0
External IDNone
Gene SPG00001669_2.0
Annotation
Prediction method(s)
(Selenoprofiles, Ensembl 68) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Full length Spliced 5UTR CDS 3UTR
Forward Reverse  
Sequence
>SPT00001764_2.0 # Transcript # Selenoprotein M (SELENOM) # Pika 
TCCGGGGACAGGGTGGTCGGCCCTCAGCAAGGGAGGGGGGCTCCCGGGATGCTGAGCGCT
TCATTGTGTCACCGGGGTCCAGGCAGGGCGGCCCTCTCTAGAGGTCAGCGTGGTCTCTTG
GGGCCCTTGGCGGTGCCTCGGGGGCCTTAGCAGGTGCCCACAGGTACTCGTCGGGCACCT
GTGCGTTGGGCTCTTCCTTGCGGTAGAAGCCGAGCTCCTGCAGCAGTGTGTTGATCTCCT
CGCGGGTCATCTCACTGAGTGGGATGCGCTGGGAGGGGGCGGTCGACGGGGTCAGCGCGC
CTGGCCACGCCTCCTGTCCCCCAGCCCCCTCCCTCCCCGCCAAGGCCTCACCTCCAGTTC
TCGGTAGCGATGGCTCAGCAGCACGAGCTCAGGATCGGCCCCGGGGAGGTGCTTCATCAC
CAGGTTGTGACTGCACAGCGTGTTCAGGCAGAAGAACAGGGGGGCATAGCAGTGGGGAGG
GGGCTCCCAGGGTCTGGCTGCCTCCTTTGCTGGGCGCTTGCTCAGCAGGAAGGGGACCCT
CGGTTTGGGGCGTGGAAATTAAGGTTTCTGCTTCCAACCCAGGTTGGAAACCTCAGAATC
CTACCCATCAGCCTCCCTGTGATACGGAGGGGAAGGAGAGGGTCTCCCAGGAGCCCCCCA
ACCCACTTGCCCATCCCCGAAAATGGACAAGGATACTAGTATGGAATGTCCTGGTAGACG
AAAGCCTTCACCTGCAGGAGGAAGCCAGGGCGTCAGGGGACAAGCCCCTCACCTCCAGGG
ACAGGTGGGAAAGCTGAAGCCCAGGGCTTGTCCCTCCCACCCAACCCCCAAGTCCTTGCA
GGAGTGGTGCCTGCTCCCCCAAGGGACTGGGAGGGACAAAGGGGGTAGGAGGAAGGGGCG
CCTTCCTTCAAACTCACCTCCTTGAGGCGGTTCAGCTGTCATCCTCCACAGGTCTGCAGA
AACATGAGAAAGGCTGTGTGTCTCCCTCCCCCCTGCCCAGTCACACATAGGGGCCAGCCG
TATGAATGGTCTCAAGGGGGGGGATAAAGGGTCCTCGTGTGCAGAAGGGTGAACTCAGGG
CAGGTTGAGAGGATTCAGGCCAGAGGGAAGTGGCTGGGGTCTTGCCTGCAGACCCCCACC
CCCCATGCACGGGAGATGGGGTCACCCAACTTCTGCCATGCTGTCCAGTCCTGGGCCTGA
CCTTTGGCCTGTGGAACCTCTGGCTGAAGGCAGACAGAAGTAGCTCTGAACAGCCCTGGG
GCCTCCACCCGAGGCCATCTGGTCCCTGCCCCACCCCACCCCACCCCACTCCATGCATTG
CTGGCCCTGCCAGCCACCTGCAGCCCAGCTCCACCGACCAGATGGTTGCTTCCTTGACAT
GGGAGAATGAAAGGCCCCACCCCTCCCCCGCATACTCCCTCCGAGAAGGCCAGACCCCGG
AAATGCCCAGTCCAGACCTCCTTGGCTGACCTACCCACTTTAGTCGCCCCCCCCCCAAAA
AAAAACCTCAAGCTCTCAGGAAGGCAGTGATGGCTCAAAGCCATCAAGGCACTCTATAAG
TGAATTTCCTGAGATGCGATGGTTTTGGGGGTGGAGCGTTGGTACCCCCAGTACTCAGCT
TTCCTCCATGGCTCCTGTGTGGGGTGCTGGTAGGGGGCTCCCAGGAATTATTTTCTCTCT
TAGGGTAAAGAAAGAGAACCTGTCGGGATCCCCAAGTCCTGGAGTGGGCCTGGGGCTGGG
GTGAGGGCAAGGGTAGAAATTCCCTGGCGAAAGTGGGAGCGATAGCGGAGCGTCCTAGGC
CCGGAAAAGGGGCTGACGTGTCTGGGCTGGATGGGGAGCTAGAGCAGGCTACGGAGTTCC
AGGCCGCAGAGCCGGGTATCCAGGCTTTGCATTAGGGGCTCCTGGGGCTGGGGACCTGGA
GAGTCAATCCCAATGCCACAGGGAGAGGAGGGAGGGGCCGAGCCTGGGGGGCGAAGGGCT
GGGTGGGTGATCTTGGGGCGGCAGCGGGGCGGGTGGCTCTCCCGGAGGCCACGCGGTCGT
GTTGCTTGGAGCTGGCGTCGGCGCACTCACCTCTACCCGCCCCCGGGCCAGGCCGCGCAA
ACGGTCCCAATTCGGCCAGTAGGTCCTGGTGGCGGTGGCCGGTGCCACCAGCGCTGCAAA
CAGCAGCAGCAGCAGCGGCGGCAGAGAAGG
Chart Advanced