SelenoDB
Release 2.0
Chart Advanced
Transcript Report for SPT00001048_2.0
Identity
TranscriptMethionine-R-sufoxide reductase 1 (MSRB1)
SpeciesGallus gallus (Chicken)
Transcript IDSPT00001048
Transcript release2.0
External IDNone
Gene SPG00000952_2.0
Annotation
Prediction method(s)
(Selenoprofiles, Ensembl 68) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Full length Spliced 5UTR CDS 3UTR
Forward Reverse  
Sequence
>SPT00001048_2.0 # Transcript # Methionine-R-sufoxide reductase 1 (MSRB1) # Chicken 
GCAGGATCACAAAACATCCCCACCCTCGCATCCCAGGAGGATTTACAGAGGACAATTCAT
ACCATGATCCCAGCCCAGAATAGCACCAGAGATTAACCCGGATTCTGATCCCAGCTAATC
CAGCAGGAGATGGCAGCGGAGCAGCTCCGGGTGGCAGCGGTGACGGGTCACAGCCCGCCC
TTCTTGGCTGTGATGGTGACAGCCCTGGCACGCTCTGCTTGCCATGGGCAGAGGAAGGGA
TGTCTGGGAGGAGGGATGGTTGGGGAGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCTAAAAGA
AGAGGAAGAAAGAAATCAGTGCCTGCGTTCCTTGCTCCAGAGCCCCCAGCCCATTTTATG
CAGTTACTTTGCCATGCACAGCATCGTGGTCCGATACGCAGAACAGCACAGCACAGCTCA
GCTGGGTGCTGCCCTGGACACAGAGGCAGCCTCCAAAATTGCTTGTTATATTGTTTCTGA
CACCAGGGAAGCGAGAAGCACAATAACCATACAGGAAGGAAGCACTGTCCTCCCTGCACT
TCCTCCCTATGCACAAAGCAGAAGCAATACCCACACCTGCACGTGACTGCTGCTGGGAAG
GAGCCAGCAAAGCCCCATCCTCCAGCAGCCTCCTGTCCTGCTTTGCAGCACCAAGGTTCC
TCTGAAACACATGGACCCGCAGCCAGCTCCATCACCCTGCATTTAACTGAGCAAGGTCCC
CATGGAGCCTGGCCAAGTTGAGACGTTTGGGATTTGTTTAGGACTGGGAGCAGCGCATCC
CCTCACAGCATGGCTGGGCTTCAGAGGCTCCCCCCAGAATAACAGCAGGGACGGAGGCAG
CCACCAAACCTCATCCCTCACCTTTAGGGATGAATTTGAGCGAGCTGCTGAATATTCAGA
ACCGGGACTGCCCCCGCTTGGGGCCATCATTGAGGAACTCGTGGCCCAGCCCATTGCCAC
ACTTGCCACAGGACACCTGGCAATATAAAGACAGGGTTCAGAAAACAAGTGGAAAAAAAA
AAAAAAAAGATAGATGATGTTAAGGAAAGAGGATTTGGGGTTTGGGGGGGGCTGTTTCAC
AGTCATCACCTTTAAGGCCCCCGGACGCTCCTTGCGCTTGGCCACGCTGTCCTCGTGGAT
GGTCTCGGTGAAGGCCGGCCAGGGGGATGAGTGCTCGTATTTGGCGCGGCTGGAGAACAG
CTCATAGCCGCACCGGGCGCATACATACACACCTGGGGAGGATGGCACGAGGAGGTCAGC
AGCGGGGATCCCCCCTCGTCCCCAGCCGCCCCGCGGCCACGTCAGCCACCACGGGACTCC
CACGTGCGTTGGACTTTAGCCACCGTGGACAACCGCCTGTCTCAGAGAGCCGGCAGCGAG
CGGGGCTCTGGGCGCCGGAATCCGCCGTCCCTACACGCGTTCCCCGCCACCACCCGGCCC
CGCTCACCCGGCTCGAAGTGGTCCTTGAACACTTCGCCTCCGAAAAAGGAGCAGAACGAC
AT
Chart Advanced