SelenoDB
Release 2.0
Chart Advanced
Secis Report for SPS00001383_2.0
Identity
SecisIodothyronine deiodinase 1 (DIO1)
SpeciesHomo sapiens ssp. Denisova (Denisovan)
Secis IDSPS00001383
Secis release2.0
External IDNone
Transcript SPT00003101_2.0
SPT00003102_2.0
Annotation
Prediction method(s)
Thermodynamic pattern-based SECIS prediction (SECISearch, 3.0) [Report annotation error]
OrientationForward
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox SNP (Present-day Humans) Fixed differences to present-day humans  
Sequence
>SPS00001383_2.0 # SECIS # Iodothyronine deiodinase 1 (DIO1) # Denisovan 
TACATATTTGTTTATGATGGCCACAGCCTAAAGTACACACGGCTGTGACTTGATTCAAAA
GAAAATGTTAT
Chart Advanced