SelenoDB
Release 2.0
Chart Advanced
Secis Report for SPS00001358_2.0
Identity
SecisIodothyronine deiodinase 2 (DIO2)
SpeciesHomo sapiens neanderthalensis (Neandertal)
Secis IDSPS00001358
Secis release2.0
External IDNone
Transcript SPT00002971_2.0
SPT00002972_2.0
Annotation
Prediction method(s)
Thermodynamic pattern-based SECIS prediction (SECISearch, 3.0) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox Forward Reverse  
SNP (Neandertals) SNP (Present-day Humans) Fixed differences to present-day humans
Sequence
>SPS00001358_2.0 # SECIS # Iodothyronine deiodinase 2 (DIO2) # Neandertal 
ACTAATGTGACTACATCCAACCACTAACTGAGTCGATGACTCTTTCGTCAGTAGTTATCA
TCCGCACACTGGT
Chart Advanced