SelenoDB
Release 2.0
Chart Advanced
Secis Report for SPS00001019_2.0
Identity
SecisIodothyronine deiodinase 3 (DIO3)
SpeciesPetromyzon marinus (Lamprey)
Secis IDSPS00001019
Secis release2.0
External IDNone
Transcript SPT00002150_2.0
Annotation
Prediction method(s)
Thermodynamic pattern-based SECIS prediction (SECISearch, 3.0) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox Forward Reverse  
Sequence
>SPS00001019_2.0 # SECIS # Iodothyronine deiodinase 3 (DIO3) # Lamprey 
CCTGTATTTGTGCGCAGCGTTCAGAACGCGTCTCTGTGGAGCGGGGTCCCTTTACAGACG
CTTCCTCATGAAAAAATACCCA
Chart Advanced