SelenoDB
Release 2.0
Chart Advanced
Secis Report for SPS00000281_2.0
Identity
SecisGlutathione peroxidase 4b (GPx4b)
SpeciesDanio rerio (Zebrafish)
Secis IDSPS00000281
Secis release2.0
External IDNone
Transcript SPT00000614_2.0
Annotation
Prediction method(s)
Thermodynamic pattern-based SECIS prediction (SECISearch, 3.0) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox Forward Reverse  
Sequence
>SPS00000281_2.0 # SECIS # Glutathione peroxidase 4b (GPx4b) # Zebrafish 
TTTGCACGTCGGGAACATCAGGCCGAACCCACCTGAACACAGGCTTGAGGATCAGCCGTC
ACACGTCTGGGCTTCACCTGCAGA
Chart Advanced