SelenoDB
Release 2.0
Chart Advanced
Promoter Report for SPR00001860_2.0
Identity
PromoterIodothyronine deiodinase 3a (DIO3a)
SpeciesOreochromis niloticus (Tilapia)
Promoter IDSPR00001860
Promoter release2.0
External IDNone
Transcript SPT00001795_2.0
Annotation
Prediction method(s)
Promoter prediction (5000bp upstream, N/A) [Report annotation error]
OrientationForward
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Sequence
>SPR00001860_2.0 # Promoter # Iodothyronine deiodinase 3a (DIO3a) # Tilapia 
TCACACACACATTCACACACTGGTGATGGCAAGCTACATTGTAGCCACAGCCACCCTGGG
GCGCACTGACAGAGGCGAGGCTGCCGGACACTGGCGCCACCGGGCCCTCTGACCACCACC
AGTAGGCAACGGGTGAAGTGTCTTGCCCAAGGACACAACAACCAAGACTGTTCAAGCCAG
GGCTCAAACCGGCAACCTTCCGATTACAAGGCGAACTCCCAACTCTTGAGCCATGATCAC
CAATGGTTCCAACATGCATGGTTCCAACTGTGAAGCATGGAGGAGGTGGTTTGATGGTGT
GGGGGTGCTTTGCTGGTGAAACTGTCAGGAAATTATTCAAAATTGAAGGCACACTGAACC
AGCATGGCTACCACAGCATCCTGCAGTGACATGCCATCCCATCCGGTTTGCGTTTAGTTG
GATCATTATTAATTTTTTAAAAGGACAATGACCCCAAACACACCTCCAGTCTGTGTAAGG
GTTATTTGACCAAGGAGTGTGATAGAGTGCTGCGTCAGATGGCCTGGCCTCCAGAGTCAC
CTGACCTACACCCATTGAGATGGTTTGGAATGAGGTGGACCACAGAGTGAAGGTAAAAGA
GCCAACAAGTGCTCAGCATCTCTGGGAAGTCCTTTAAGATGATTGGAAAACCATTTCAGG
TGACGATCTCATGAAGCTCATCAAGGGAATGCCAAGAGTGTGGAAAGCAGTAATCAAAGC
AAAGGGTGGCTATTAAGAATCTTAAATATAAAATATGTTTTGAGTTATTTCATACTTTTT
ACTTTACTGCATAATTCCATGTGTGTTCATTCATAGTTTTGATGCCTTCATTGAAAATCT
ACAATGTAAATAGTCATGAAAATAAAGAAAAAGCATTAAATGAGAAAGTGTGCCCAAACT
TTTTACTGGTAGTGTATTTGATAGGGACATTCTGTGGCCATCTGATAACAAAAAAAAATA
AAATAATTAAAGCCTATTGAAAAAAACACACAGAAAGGTGGGCTATGGTTACTGTACTGT
AGAACTGTTCCAGGTTTGAACTAGAGATGGCATGATACCACTTTATGTCCGATACTGATA
TCATAAATTTGGATATCTGCCGATACTATTATGAATCCGATATAGTCCATTTTATAATCA
ATAAAACTGTTTTCTTTTATATCTTGCTGCATTTTGTAGAAGTTCATACTCAAATTTAAA
AAGACAAAACAAAACTATTGTATTACGAAAAATACACTGCACCCAAAATATTCAGCTAAA
CTAGTCTTTTTATTTAATCTTTTAACAGAACTTTAAATCCAAGTATTTAAAGTAATATTC
AAAATGTTATTTAAAATGCAATTTTATGCAGATTACAAAATGTCTCTGGTTCTGAAAAAA
AGAAGTGCAATATCAGCACAAAATAACGTTTATATTCAACAACTAATAAAAAAAACAAGT
TGTAGAATCGACCCTTTTATACTTAACATAAATAGACCTCCAGAGTGGGAAGCAGTGCAA
ATAAATGTAAACACTGCTTCATGACACTCTTCTTGTATCAAGATGGATGTCAGTGTAAGC
GGTTTCTATCACATTTAACCTGAGACTGAATTGTGTGTAATTTCTATACAAAACTTAAGA
CAAGTATGAAAAAAAAAATATTTTTCATGTTTTTTTTCTTGGAACCACAGAACTGTTTAA
CCTGCAACAGTTTTTTCAAAGTAAAACTTGAGTCCATCCATTGTACAGTCATACTTAGTG
GTGACAACGCACAGACGTCTGAGCTCCATATATCGGTTGTCAAGCTTAATGTTGGAATGC
TTTAAAAACATTCAGCGAATAACTTACACACTTGCTTTACTTCTCTGCGATAGCTTGCGC
AGAGATGAAATGCCGGTTTGGTAGCACGTAGCGAGGCTCCAAATGCTTTCAGGGTAAAGT
AACTCCAGACTGCTGACAGGTCTCACACGCAACAGCCGCTCTTATCACGTGACGCATACT
ACTCCCATGTGCTAAGGTAGGGTTATGTCGCAAGTTTTGTGAGGTGCCTTTTTTATATTT
AGTCAGGTTACATTTTTTATTTCCTAGGTCAGGATCAGACCGATACTGATACTATATATC
GGATCAATCCTGTCCCTAGTTTGAACAGCAGGTCATTGGGTCTTCTCTGCTCACAGTAAG
GGCTGTATGGCACAGATGACCATATTCAATATATCCTCTCTTGTTGACATCATGTAGCTC
TGAGAGGGGAGTGTGAAATGGAACGCTTACAGCAGTGTGGAGACCATTTGATGCACAGGG
ATTATTTGTACATGCAACACTTAATGACAACAACAGTCATGTCAATGTACTTTATATTAT
AAGGTAAAGACCCTACAATAATACAAAGAAAACCCCAATAATCAGACAATTCCCTATGAG
CAAGCACCTGGCGAAAGTGGGACAGAACACCTGCATTTTAACAGGAAGCAGAACCAAGTT
CAGGGCGAGCAGCCATCTGCTATAACCAACCAGTGATGAGAGAGAGAGACAATGCAAAAG
ATACACCTGATCCAGCCCTAACTATTACAAAAAAGGGAAGTTTTAAGTCTAATCCTAAAA
TCAGAGATTGCGTCTGTCTCCCAAATCAAAACTAGGAGCTGGTTCCAAAGAAGAGGAGTC
GGAAAGCTGAAGGCTTTGCCTCCCATTCTACTTTTATATAGCCTAGGAAACACAAGCCTG
CAGTCTGACAGCGAAGTGCTCTATTGGAGTGTGTGACAAAGTGGGTGAGAACACCATTTG
TCCATATTTGAAGCTTTTTATTCTTAGTTAACATTCTTGTTTTGATTTAGCCATACCTTA
TTTTTTATTCTGTAGTGGGCAAACATATACTATCCGGGGTTTATGTTTTGCACTTTCACA
GATTATGTAACATCTTGGTTTAAATCAACTCTGACAAGTTTGTTAAATTAACATTATTTA
TTCCAACTGTTAGTTTGTCTAGTTTGTTGAACTCACCTTACTTACCTATGTTCCCGGAGC
AAAAGGAGGAAGTGCTGCCTCACTTCCTGTATTTATAGCTTCCTGTTTAGTCTAAGGTCA
CAGGAAGGGACCAGGTGAAGAAAGGGAAGAATTGTATATAATAAAGTCAATTTCAGCATT
GTTTGTAGAGAAATGGATGCATTGATGTAATATGTATTGGTTACACCTTAGAGTGTTTTT
ATTGCTAGTAAAGAGTAGCATCGTAAGTTTATGAGTATAGTAATGTTTGTCTTACCTACT
GAATGGAATAGTCCAGACAAATTGTTTGGATACCTGAGTATTTAAGCAGAAGAACTCAGG
TGTTCAAGAGGAAAAGACCAGGTCAGTGTAGCTGAGTGCACGTGACCTTAATTTTTGTTG
GTTTAAGTTCAGTTATGTTTATTTGTACTGAGTTAACTTTGGTTTTGAGTTTTGTTTTGT
TTTTTTGGTAAATATTTTTTGTCACGAAGATGGTGAATAAATCACTTGCTACATCTGTCT
CCTGCCCTTCTTCAGCCACTTTGGTCAAGCTGTCTCACAGGGTGACACGGTACTATGAGA
TCTGTAAGATAACATGCAGCCTCATTATTCTATACCCATATGTGAAGAGAAGCATTTTGA
TTTCAATTCTGGATTTAACAGGGAGCCAGTAAAAAGAAGCCAATGTGTGAGGAAAATGGT
CATCCAACTTTGTAACTTTGTATATGTGTGATGACAAATACTGAACAGCATAGTCGATTC
CCCTTTAAAATTTCTGTAGGTGACAAGAAACTGTATATTCCTATTTGTTTTTAAAGGCGG
TGTACGACACAGCCAATGCAGTGAAACAAGCCATGGGGTAGAGAGAAAAAGGTAGGAGGA
GGAAAAAAAAGAAACAGTTTTTAAAAAACAAAGAGGAAAGGGGACAGACTCAGGGGTGGG
AATGATGGTTGGACACATGCTGGGAGTGTTATGGCATCAGAGAAACAGATCCAAGCAGTC
ACATGGATGCCATGTCATCAACGCCTGAGACGAGGAGGAAATTTCATGGTGAGGCAACAT
GATTTGCTTCGGCCTTTTTGTATCATAGTGAATAGGAGGAACTTAAGCATGAGAATACAG
TCATTCCACATTTCTTTTTTTCCTGTGTAATCATCGTAAATACGAGGAACTTAAGTATGA
CAATACAGTAAATTCCACGTTTCATTTTCTAGTTTAATCATCATTTACTAGACCAGACAG
TCAGGAACAAAAAGTTGCTTACAAAATAACAGATTTTTAACTTACAATAACCCCAAAGCC
CAGCTCAGCATGGCCTACTCAGTGTTCATAGCTCCCATATACGAACCTTCATTTTAATCT
CAGCTACACAATGCTGCCCAAATGTTGCTCAAAACATGCACAGTGATCATTTCCTCTTCC
GTTTGTGTCTTTGGGATCATGTTTTGCCATGATCACAGGCACACACACACATGCACTTCA
GTTTTGAAACTGGTGATGGCAGGTTTATGCTGCCTCCTTTTCCTCACAAGGTGTTGAGGG
GCCCTAGACGAAGCGAATGACTCATCCAGCCTGGATGGTCTGTATGAATCCAGCGCCGTC
TAGTGGCCGTAGAGGCCCCTGAAGCATGAAGTGAGTCAAATGTTTTGCCTACTTTCTGAA
CCAACCGTGCGAAGCCTATATGCCCAATAAAGTACAAAAAAGAAAAAATAAATATAAAAA
CAAAACAAACCCCAAGAAGATAGAGAACTGTCATGTGTTATCAACATTCAACCTCTCAAT
CTCTTTCTCTCTCGCTTCCCATGTCTTTGTGGATCTTTGAAGCCCAGAGTTGACGGGAGG
TAATCCCCACCATGTGAGTGGGCGGTGCGGGTACCGGAGGCGTGTCCCCCCCCCCCTCCC
CCTCCTCATTATTCAAACGCTGCTGTACCTATAAAAAGAGTGCCTGCGTGCGTCAGATAG
TTTTCTCCAATGGGTAAAGGTGACTAAATTCCAGTTGTCTCGTTTGCCGGCACAGTCTCA
TCCTATCAGCTGGGGGAGAG
Chart Advanced