SelenoDB
Release 2.0
Chart Advanced
Promoter Report for SPR00001631_2.0
Identity
PromoterSelenoprotein K (SELENOK)
SpeciesMus musculus (Mouse)
Promoter IDSPR00001631
Promoter release2.0
External IDNone
Transcript SPT00001566_2.0
Annotation
Prediction method(s)
Promoter prediction (5000bp upstream, N/A) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox Forward Reverse  
Sequence
>SPR00001631_2.0 # Promoter # Selenoprotein K (SELENOK) # Mouse 
CATCTTCCCTCCAGTTGCCTGCTTCCTAGCTACAGAGAAGACCGGACCCCCTGTTGTTGC
CATACCTAGCCTCCCACCCCCTCTTGGTTTTTTTTTTAAGAGGTTTATTTAACTCATAGT
TCTAGCCATTGAACAGCATGGTGCTAGCAACTGCTTAGTTGTTGGGGAGGAGAGTTGACT
TCTGGAAACATCACAATGTGGCAAATGTCATCAGTGTAAGAACTCACATAAGAGGCAGGG
CTATCAAAGCACGCCAGAAAGCCAGGCAGCTTTAAGGGACAAGCCTTGATCTTCCTTCTT
ATGACAATCCAATCCAAACTTCCTTCTTATGACAAACCAATCAGGGTCCCAAAAGAATCA
TACTTCATACTTTAAAGCTGGCACCCAAAACCAATTCCTCTCTTACTAGGTTCTACAATC
TCAACACTGCTGCACTAGAACCAAACTTCTAACACATGAACCATGGCCTGGGGCTTGGTC
AGTGGCAACACATAATCCCATATGGACCCTGAAGTCTAGCCAAACCAGCTAACAGTCTGT
GGATGTTTAGCTTTGTGCTTGACACATGAGCATCATGACCATGAAACAAGCATCCATCTC
TTTTTGAACAGTCATTTGGATCTCAGCTCAGGTTGCAGGTTCCAGCCACGTTGAGCAGAT
AGGCATACAGCATTTGCTTTCAATGTACATCACGTAATCTACTAGCTGTTTGCTTCCTTC
CTGCCACTGCACTCCTTTCCCAGAAGGAAGTCATCTTGGACCTTACAGGTGATAGAAAAA
AACTCACAAGTGCAAAACAGAGTAGAGCGGGGCTCTGGCTGTCATGAAGGGAATGTCCAG
AACAGACCACAGCCCCTTGAAGTGTTACACATCAAGAATCAGTTATCTTTGAAGCTGCAG
AGATACCCACCAGGACAACTTCTTAAGGCTTTCCCAAGGTGTAAAAAAACCAAAGTGCTA
AAACAACCAACCAAACCAAACAAAACAAAACAAAACTACTACTACCAAGACTTTCATGTT
ATGATGATGTCAAGGACAGATGCGTGTTTTGTGGAATTTGAACATCCTTCATATTTTAAG
TCTTTCTTTAAAAATATGATAAAACCACAAGTATCAAATTTGGTTGTAGAATAACTCCTC
ATAGGAATGGAGAATACTAAGCATACAAACCACAATAATTTATACATTTGAAATTTCATT
AACCCAGTCTGGCTTGCTCTACTAATACTGTGTTAACCATATTTGGCTTTATATCTTTTA
CTATCCCTTTATCTGAAAACTAATCACTAGCTTTTCCTCTGCAGAAAAATTAAAAGTCTG
TCCTAAATCAAACCAAGGAACCAAAATCTTTATGTTGGTGATAGCTTCGACACATTACTT
TGAGCCCTGTCATTTGTGCTTGTGACATCTTTATCTATGCTTGGAAGTGGTCTCAGTTTT
GTCCTAAAGCTATGAGACTGAAGGGGCTCCTGAGGGTTCTCTGTGGAGTACCTGGCCCAA
CATTTTCATAAACAAGTTCGTGGTAGATATCCTCACTCTAGTGGCATATCAACAGTTACA
CTGTCTCTATCAGTGGCTATCTGACTTTTAATCAAATAAAATGGAAGTTCACATACTTCT
CCTACATGTTCTCTTTCTGTCACCAAATGATCATTGAACCCAAAAGCCTTTATTCTCCTC
AGATGGTAATTTCTGCCCTCCATTAACTGCTTTTGTTTATATACATGGATGAGACCCACT
AAACCATGGTCCTCACTGCCTGCTCCTTTCAGATGCACCAACCTATAACTTGTTATGGTG
TAGTTTGTGGAGCCACATCATACTGTGAGCAGAGCTTACTCAGCTTTTGCAAACCTGTAT
CTGTACTATTTCCTCCTGTAAGACCTTATTTGCGCTAATGAAACTCAAGCTTTAGCAGGA
CAGCAAACAAATGAATTAATGATAATAAATACATGGTATGTCGCCACAACTATGTCCTAT
GCTAGTTCTGAAAATATAGATTCTAAAAGAAGTAATATTAAGATTGGTCGCTATGTTCCT
TAGCTCAATAATGAGAACAATAAACACAAAATGTATCTTTCATTAGTTAAGCAAGAATAG
TTTGGAAATTTCCAGAATTAGCCCTTTAGCTGAATTATCAAAACCCAAATTACAGTGGCT
CCACTCCATAACCACCTGTGTGTGTATGTGGCAGGGGTGCATCTGACTTGGGGGGTCCAG
CTTGTTGGCAATGATATCAGATGCTTCTGAAGAAAAGCTCTCTCCATCTTGTCTGCCCTA
AACTTGTTGATTAATTTGTTCTTTAAAATCCCAATAACTATAGAAATTAGTAGAAAAAAG
TTTGAATGAAGTAAAACAGTTAAGAAAATACTTATATGTAACCAAGAATGGATTATATCT
CCAGGGTGTCATCATATGATGCTCTAAGGAAGAACCAATGATAAGCCCAATAGAGTATAG
ACTGAGATTCCATTTTGAGAGGAAAGTTATATCAGAAGAATAGTGCTCCGGAATGGCCAT
GTGAATTCAAGAGACCTTCAGCCTTTCTGGTTCAGATGAGAATGGGCTCTGCTCACTCTA
CCTGTTGTGTAATTGAAAATGGCTACTCCAGTTTTACATTCTCAGACGTCTGCTGTTTCA
TGTATGTTTCTACCTACAATAAAATCAGCACAGGAAAAAAAAAGCAAAGAGGACTTTTAT
TGTTTCTTAAAAATCAGATATTTCAAGTGCTGCCTGGAACCAGAGGTAGAAAACACCTTA
GAGTTTGTGAGAAATGCAGTCTCCCATGGGAGACTCAGATGCACATTACAGTTTGAGAAG
CACCAGACTTTCTCCAATACTAATGGCTAATGGAAATTCCAATGAAAATGATCTAATTTT
TAATTTTTATTTAAGATTATCATTTAGTATATGATGTGTATACATGGCTATTCATGTGGC
ATGGCACATATGTGGAGGTCAGAGGGAAACCTACAAGAGTTGGGTTTACCATATAGATTC
TGGACACTGAACTAAGGTCATCAGGTTCCACATGGTAGCCACCTTTACCCACTGAATTGT
CTGATTTTCCCCACTTCCCTCCAACTAAAGTTTAATGGGCTTTAATGAAATAATACTATG
GACAGGTGGTTCTCAACCTTCCTAATACAGTTGCTCATGTTGTGGCAAGCCACAACCATA
AAATTAGTTTTGTTGCTACTGCAACTTTGCTACTGTAATAAATCATAATGTAAATATCTG
ATATGCTGATGATCTTAGGCAACCCCTGTGAAAGGATTATTCGACCCCCAAAAGGGTTGC
TACTCATAGTTTGAGAACCACTGTTATAGACAGAAATTATCAAATGATGGAAATATATGT
TCATTATAAAAACAACAAAACATAAAACTACAAAAAAATATTAAAAGGTACAGAGGAAAA
ATTACCTAGAAAGCCATTACCAGGTATTGTGGTTTAAATACAAAATGTCCCTTTTGTATG
GATATGAATAGTTAAATATGAAGTGGCTCATATTTTAGTTAGGGTTTCATTGCTATGAAG
AAACACTATGACAAAGACAACTCTTTGAAAGGAAAACAGTTTACTGAGGCTGGCTTAAAG
TTTCAGAGATTTAGTCCATTATCATCAAGGCAGGAAGCATGGTAGACAGGGGGCCAGAGG
AACCAAGAGTTCTACATCTTGATCAGAAGGAGTGTCTGATTATACACTAGGAAGAGCTTA
GGCACAGAACTTCTCAAAACCCACTACTTCCTTCAACAAGGCCACACCTCCTCATAGTGC
CTCTCCCTGAGGTCAGCATTCAAACACCTGAATATATGGGGCTAACCCTATTCAAACCAC
CACATTTCACTCCCTGGCCCTCATAGGCTTGTAGCCATAACATAATGCAAAATGCATTTA
GTCTAACTTCAAAAGTCCTCATAATCTATCACAGTCTCAACAATGTTTCAAAGTCCAAAG
TTCAAAGTCTCTCCTGAGATTTATGCAATCTCTTAACTGTAGTCCCTTGTAAAATCAAAA
TTAACAAGGCAGGCCACATACTTCCAATATAGGATATACATTACCATTCTAAAATATCAT
ACTAAGGAAATACTGGACCAAAACAAGACCAAAAGCCAACTGGACAAACTCCAAACTCTG
TGTCTCTGTACCTGATGTCTAACTCTTTTCAGCCTTGTTGACTCCAACACAATTCTTTCT
CTTGGACTGGTTCCACTTCCTGTTAGCAGATTTCTTCGGCAGGTATCCCATGGCTCTGGT
GTCTCTAACATCATGGGGGTCTCCAGGGCAACTTCAACTTCACAGCTTCTTGTTCCAGTG
TCTGGGATCCATACAGGATCTTCTGGGCTACTCCAAAGGGCTTGTGCCACTTCACCAGTT
CTGCCCTCTGTAGCACTATAGGCTTTGGTCGACTCTACTCCACTACTGCTGCTGTTCTTG
GTGGTCATCCCATGGTACTGGCATCTCCAATATTCTGGGGTCTTCTGCTTCAACTAAGCC
AACTAAGCCTGCTTCACTTTCACCAATAGCCTGTCATGGGCTTTCTTCATGATACCAAGT
CTCAGCTTCTTTACATGGCCCCTTCATTCTTGGGCCTTCCACTGCCACTGAGACTGCACT
CTCACGAATGGCTTTTCCTGATCTCTCACAGTGCAAACCACACCTATTCTCCACGACCCC
TTCATTCCTTCAAAACCAATACCACCTGGGTGATTCTTACACATTACCATGTCTAGCTGC
CAGCATAAGGTCTACCTCTGGAATACAGCTTCTTTGTGCTCTCTGAAAACACTTCCCAGA
TTTTACCTCAGTGATGCTGGCCTCTTCTTAATTACTACCAATTTCTTAGTTCTAGCTAAC
CAACATCAATTGTCCCATGCCCTTTACAGTGTTGCTCTGATTTTAGCCCAGGATTGTACA
TGGCACTCTGCCATTATCACTGCACGCTACTCATTCTGAGTTCATCAAACTGCAGCATCT
TCATCTCACCCAGACTCATG
Chart Advanced