SelenoDB
Release 2.0
Chart Advanced
Promoter Report for SPR00001135_2.0
Identity
PromoterGlutathione peroxidase 8 (GPx8)
SpeciesGasterosteus aculeatus (Stickleback)
Promoter IDSPR00001135
Promoter release2.0
External IDNone
Transcript SPT00001070_2.0
Annotation
Prediction method(s)
Promoter prediction (5000bp upstream, N/A) [Report annotation error]
OrientationForward
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Sequence
>SPR00001135_2.0 # Promoter # Glutathione peroxidase 8 (GPx8) # Stickleback 
AGGAAGGCCGTGACCTGTGACCAGGCACTTCTTCTTCTGGGCCCAGCGCAGAGAACAGAT
CTGCAATCCGAGTCATAAAGAACAGTCAGTCTCATATGTGAACGCACAGGAATCCGGAGG
TCTTGTTGGTAGCGAGGGGTTGTTGAACTGTCCCCTTAATCACCTGAGAATTTGTGTTTG
CAGAAGTCACGCAAGTCCCCGAATCGGTGTCCCAGACTCTCAGGTCCCCATCGTTCCATC
CGCCTCCTGTGGCGATCATTCCTCTTTGCCACGGACACCAACCCATTGCCTGAGCACAAA
AAAGACAAGTAAAACAATATAACAGCTTTGTTTTCATTTCAGAGCCCCCCCTCCATCACT
GACCTTAACAGCGCTAGGCTGTCTCATCGTGGAGATTGGCTGACGTGACCATGTGATCCC
CGCCATGTCCCCCCCCCAAATGCAGAGAAGGCCCCCTGTGGAGCCACTGGCCAGCCGGTC
GCCTCCCGGGGACCACTGGAGGCCGCAGACCTCCTCCGCCTGGACCACGGCGCCCACCAA
AGGCTCAGGAGCCCGGGGATCCAGGTGATGGATGCCTCCGAGAGCAGAGCCGCTGTGGTC
AAGCGGGTCAACAGTCATTCCTGCATGAGGACTTTTACGCTTCATATTTGTTGGAAAATG
TCATGTCAAGAAGGGGGTTTTAGACGAAACAAGACTGTGTCTGTATGGTTTGTACAATAA
GTTTGGTATTGATACCGGTTGTGATGCCCTTTATTTTATATATAAACAGAAGCTATGTTT
CCATTTGAATGTGGAGATCATTCCTGCTCTGATGGCGTTTGTAGAGTTCAGAATGATGCT
GAATTTCTGTGCAACTTTCGTTTTGCGTTCGGACAACACGAACCTGCTGAGTAAGTGCTG
GTTCCAGGAAAGCCCTCTAACCACGGAAAGATGTGACGGCAGACACCTCATGTTTCGCTT
GTGTTCGACATCCCACAGCTACCAAAGTCAGAGAGAGAGAGAGAGAGAGAGACCAGTAAC
CAGTCATTCTGCTGACATTACCCCCCTCCAGCCCCATACCGCACGTTTACATGAATCAGT
CCCACCCTCCCCGCTCTTTTCACGCCACCTGTATCTCTCCTTGCCGGGTCCCGATGCAGA
GGACGCCGCCGTCCCTGCTCCAGCTCAGGCAGGAGATGGACGGCGCCCGATGGCGCGCCA
GTCCCGGTTGTGGACTCGGGTCCAAAGATCCCGCCAGAGCCCCAGTTTGTGAATTCCACA
GGTAGACCGAAGAGCCCAGCGCTAACGCGAGCACACCTTCACAACTGCAGTCGAGAAGGT
GAGTATCTGGAAAGGAGAGCAATGGAAACGACAGAGAGCGTCCTGAGTCAAGTCTGGACA
AACTGTGCCGTCATGTTTGTCCCAATCCGACAGCAAGATCTAGAGGCAAGAGCAGGGGTC
ATGTGACTACAACGATAACAGTCCCTAACACACACCCCACAACCAGCAGACAAATTTGAC
CAGAAGCTAAAAGTTTTTTTTTTTTAAATGTTTCATATTTTTTGTTTATTGTTAAAGCTG
GAAGCTCTAAATCCTGTTTTCCGTCTCCACTATAGTACCCATAGACTTGCATACTGCATA
TTATAATTAGGGCTGTCAACAATAACGCGTTAATCTATGCGATTAATGTGGCCGGGACTA
AAAGATTTTAACGCAGTTAACGCAACTTTGTTTACTTCCGGTGTGCCGGATGTAAACGAA
ACCGCCGCTAGCTACAGTGAGTTAGATGGGAGAGAGCAGGTCGGTAGCTGAAGAGGAAGA
GAGTGCTTTGCATTGCAAGGAAAACAAACGCAGAGGAATTCCATCACGTGTCAAACAGAA
GAGGAGTGAGTGGCAAACGGAGCACTTTAGGCACCGCTAGGCTAAGCTAGCAGAGGACCA
CTACTGTGTCAAAAACAACCAAACCAATCGCAATTAATGTATTTCAAAATGTGCGATTAA
TTCGTTTTTTTTTAATCTATTGACAGCCCGAATCACAATATATATTGTTTATTGTCTCGT
TGACCTATGAGAAATGACTTGATTTAAAAAAGCCCAAAGCAAACACAATCTATAGGCCAA
GGTAGTGCCCCAACAAATCTACCATTACCTGCAATTTATATTACATTGGCTAAAAACTAT
ACGTTGTCCAGCTGTTTTGGGAAAAGATGCAGTCTTATATAAAAGTTAAACTGTATATTT
GTGACACAGACGGGTTAGGCGGACTAACAGCTGTTGGTTTGGTCTCTTTTCATATAGAGA
TACAGAGATTTGCTTCTTCCTCTCTTACAGTAGTCATTCAGCAGCGACGGTGCCGCCAGC
TTCATCACTGACTTTCCCTGCTGCCTTGTTTTTGTTTCGTCCAAGAGAGCAAAGGGCTGC
AGAGCACGTCTTCTCTCATCAGTCCCTGTAATGCGAAACACATATTAAACAAAACCCAGT
TACGACACATAGAGATGCGACAACTGAAACTCACTGAAACTAAAATGAAATCCTATACTT
TGATGGTGTCTTATGAACCGGATCTAATGTGATGATACATAAACAAAACCGCCCCCGGGC
CTCGTGCACTCTCTGTTGCTTGGAACCCTTTCTGCAGATGGTTTGGCCCAGGCGTTCTCC
TGGTGTGACAAAGTGCAGTACGCTCTACGGCAGGGGTCTTCAACGTTTTTCAGGCCAAGG
TCCCCCAAACCGATGGCGAGACGGAGCAGGGACCCCCTATTCTACGGAGTTTGGTCTGCC
ATCTTTTATTTGTGAGAAAAAAATTGGTTGAAAAAAATAAAGTAAAAAACAATTAAAGAA
ATATAAAAAAATTGTCTTATCAACCAAAAAGTTCACGAACCCCCTGCAGTACCTCCGCAG
ACCCCCTGTTGACCTCTGCTCTACGGCTCAATTACACGTTATTTTCGGGGGGGTTACCGT
AATAAAAATCATCAAGAATGTGATAAAAAAAAGGAATATGCTGTACCGGCCTGATATGCA
CCTTCATGTTCTGGAAACGCAGCTTTCCACACCCATCCCTGCAAAAAGAGAAGAAGATTT
CCTCTTATAAATCTTAGCATTGCTTTTTCTAGTTTGTTTTGGTCTCAAAAGGTGCAGTTC
CTTGAAACAGAATGAGCAAAAAAAACAGATCTGTTGTTTTTGCATCTGTCTGATCGCTGC
TTTTCAACTTTGTTATTACTCGGATCATGTGATAAATAAGAGGTACCTGTTGTGGGGTAT
TTTCTGGTGCGGGCCGTCCCCCGGCAGGAAAGGAGCGTGGTGTGTTTGCTGTCTCTGATT
AGGAGAGATGATCACAGAAAACACTTCATCACAAAGTGACAAGGAATGGACACCTGGGTG
TTGACATTACGTTTGTTTGGGATGTTTTACGTGCAATGCATTTGGACGCATGTTGTTTTC
AGACTTTTTCACATGTTTCTCTTTGCACAACAAAAACTGAAATCATTTTGGATTCATGGG
GTGATTTATTCCCCCCCAAAAATGATATATTTCTACTTCAGCGTAACACAATGTACTAAC
ACGTCCATAACACAAGCATTCCTATACCAGTTTTGCCCTCTGATTTTTATATTTTCCGAT
ATTATGCAGTAAAAATACCTAACGTTTTAGATGCCATTTCCAAAAGCCGAATTTTAAAAC
CCCACCAATAGTTTTGAGTTCTAGATGCCCAAATTCTTCTGGGGAAAGTAAAAATATCAT
GTTCGAAAACAATGAGCAGATCAATCTGTGTCTTTGTACATTCAATTGTGGGGAAGAACA
CAAAAATAAAGTTTTTTCTTCCATTTTTAGCTATTATTTATTGATATAGTGTAGCGATAC
TATATAAAATAGCAACTCGCCATATATGTTGATGTGATTGTGTACTTTGTAACCTGTTAA
AACTTAAAATAAAATAAAAAATAGCAACTCATTTGGTGATCTGTGAGATCGCTTTTTGTT
TGATGACGTCACACAGGGGTCCGAACAGTACCTCGGTGCCGGCCGTCCCGGGCCGGTTCG
CGGATTCTCGGCGGAGAATCCAGCTGCAGCCTCTGGCGGACCGTGTGGAGCTGAAAGCTG
GACTCACGCTGCCGCCAAGTGGCCGGCGGGGGTCCCGCTGCCAGCGGGGTGCTGGCGGCG
GGACCCCCGCTGGCGCTCCGCCGGATGATCCGCCTCCTGAACCGCTTGTACGAGACGCGA
TGGGCCTCGATTGGTCCCTGAGGAGAAAAGGGAACGCAAGAAACACACAAAAAGGCTCAA
TAACCTCAGAAAACAACTGACACAAACTTTACAACTCTACACATTTTAAAAAGCACAACT
AGTTATCGAGGTAAATAGCAACACGTCCGGTTAAGACTTTCAAAGCAAAAGCATTGTAAT
TATTAGTCCAAAGGTCCTGATCTTAAAGGTGCAGTATTTGACCATTTCAATTCATCCTGC
ATTAAGCCTATTGGTTTGTAGCTACAGCAACACTGTGTGTTAAAGCAGGTTACATACATT
CTGCTTTCATATCACAGCTAATTGCATGAGTTGAAGAGTTGAAACTAGATTGAGACAATA
AACTCGTGTTTACATTATTTAAAGAGGGAATTCATCAAGAGGAAGAACAATCATTATCTC
TTAGACTTTGATGTAAACTGACTAAATCTTCGCAACTGGAGGAGTCGCCTTTACTGTGTA
CCTGTTACATGCCTCCGACACACGACGTCCCGACATTCATTTGAACTCTACTCTTATTTT
GGAGAAGCTCTTGCGCTCAGCTTCCGGGTGTCGCCGACGCGTCCTCGCTAACTTCAGCCA
GTCTCTCCCCGGGACTTTCTGCAGGAGGCTCCCGTCTGCCCCCACGGTTCACTCCCCTCG
CCTCCGACATGGAGGCCTTAGGGGGCTACCCCGCTAAGTCCAGCAGCCCCAAAGCGCGGA
CTCTGCGGGTCGTGGTGAGCATGACGGTCGGCGTGGGCTGTTTGCTCCTCCTGCAGACGC
AGCTGAATCCGAGGAAACCC
Chart Advanced