SelenoDB
Release 2.0
Chart Advanced
Sequence Report for SEQ00001652_2.0
Identity
SequenceSelenoprotein K (SELENOK)
SpeciesOchotona princeps (Pika)
DescriptionGenome -assembly-
Sequence IDSEQ00001652
Sequence release2.0
External IDNone
Gene SPG00001654_2.0
Annotation
Prediction method(s) None
OrientationReverse
Toolbox Forward Reverse  
Sequence
>SEQ00001652_2.0 # Sequence # Selenoprotein K (SELENOK) # Pika 
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNAGTAGGAAGGTCCATTTTTCCTCTCTCTTCTCTTTCTTT
CAATATAAAAAGGATCTCCCTCTTGCTCGCCCCTACAAAAAAACAGGCAGGAATTTATTC
AAATAAATACTCCATCAGTAGAATATAAAAAAAGCTCTCATCTACTAACTGAAGAACATT
TTCATCCATCAGAGATACATCATACTTGTTGGCAGCAGTCATTCTCCGTTTCCTGTCTTG
TCCCTCAGCAGCCGCTAATCCAGTTTGTATCTCTACAAACTTGCCTCTCCTAGGTATTTA
ATGATTAGAAATGTATAATATTTGGTTTTTTATGTCAGACTTTTTTTTCATTGAGTATGT
TTTCAAAGTTATGTGTTAGCATATATCAGTATTTCACCTGTTCTTGTGACTCAATAATAT
TTAATTGTGTACTAAAGTTTGTTTACCCATAGATATTTGGTATTTTTCACTTTGTGACTG
TTATCAGTAAAATACATGGGCAGGTTTTTGTGTTGCCATATGTTTTCGTTTTTCCTAGGA
GTGAGGTATTTATTGGGTCATATGAGCAATCGCCAAACTTTCCCCAAGGTGTTGCATCAT
TTTATATTCCCATCATCAATACATGAAGATTCCAGTTTCTCAACATTCTTGCTAGTAGTT
GTTTTTGTTGCCTTATTTTTTTTCTGAGAGGCTCTCTGTGCCTGTTGGGACATATCCTGC
ACACTCAGCCAGGCTTACTTACCACTCCTGATAGTGTTCCCTTTGCTTGCTAGCAGAGTT
TCACAGAGTCAGAGGAATTGCTTAGGGCCTTCTCACATCTTGAGCTCTCACACTGCCCTG
GGCATATGCCCTTGACCTCTGACTTGATTTTGAAGTTTAAACAGAAGTTTCAAAACTGTC
TATGGGCATTGCATTCCCCCATTTTTCCTTTTTATGCTTTTTTAGCTTAGCATGTTTGCT
CCAACTGTTTCAGGCAGCTGAGATGTTAAACAATTGCAGCTGGTTGTTTTTGACAAATAT
CCTTGGGGAAAAGGCTGTTAGCACTGAGCAGGCTCTGAATCAGGTCAAATCACAGGAAGC
CTTGGGAGTGGGTTTTTCAGGGAATTGCCAGTCCACTGAAAGTAGAGCTTTGAAAGAGCT
CTAACTCTGCTCTGATCTCTCCAGGGGTTGCTGGGCTGGAGGACTCCAGTGTGTTTGAGG
GCTGTTGCTTTTCCAGGCTAAGCTGGAGCTGGGGAAAGGTGAAGGGGAACAGGACAAGTT
CAAATGCTGTGAAGTGTGTGCTGCTAATGAGATTCGTCCATGCTTACACTCTTTCCTTTA
TTTTGTATTGGCAACTTCTGATGATTTATTTATATAAAGTGAGGAGTATAGCATAAAAGT
ACTATTAAAACCTAGTTGATACTTTCAATAGACTTTCTAAAAATATAATGATGTACACAA
GTGCGTTTATCAAACTGTGTGTTGTGTCAGATGTCTGCAGAGGGACTCTCAGCATGACCT
CATTCATCTGAGGACAGGGAACAGTTCCTCTTTGGATGCGCACATTCATGTGCTCATCCA
GCATGGTCAGCCCTCTGCTTTTGGTGACTTCTTTGTGTTTTATGAATGTGTGTCCAATTG
TGAGTTTCTTTCAGCAACATTTATCTTTTTCATCCACTAGTCAGGGGAAGAGAATGCGGG
CCCTGCAGATGATTGATTCCATTCATTGTTTGGGGAGGGTTTTCTGGTGCCTCTTCTGTC
ATCATATCTGAAATCACATGAGTTTCTCTAGCCTCTCTTTTCTGCACATTTTGCTGAAGT
AGGGTTTTGAAAAACAGCCACAAACTTGTCTGTACCCCGGAAGAAACTGTTACCACAGAT
AATCTGCGTGGAGATTGAACGGCTGTCTAGCACGTTGTTTATTGGAGCTGTCAACTATCT
TGTCTCCAGTTCCTTGCTTTGAGTGTCTCTCAGCTGTCTTTTATGAATAAGTACTTCTGA
GATTATTGCAGATTTTTGGTGAATATTAAAAGTCTGAACAGGTTGATTGATGTATGACTT
TTGCTTTGTTCTTTGTGTTTTTAAGGAAGAGAGGATTTTGCAAGTCCATACTCTGCCTTT
CTCAATGATGTCATCCTAATTGGTTTTAGACATGTTTATATCTATTTTTAAATCCTTTTA
TCCCTTTTGAAATATTGCATGGCTCATATGAAGTTGCAGAAAAGTAGAGTTCCACAGCTT
GCTCGGCTTTCCTTGATGATTGCCCAAACCAGGAAATTGGCGCAGTACTCTTAAGTTTAC
TGTAAACTGTATTGCATGTTCATGTTTTTGTAAACCCTCTTTTTAATTTAGATAGTGGTG
ATATTTATATTATATATAGTTACATATTAAAAATCATTTCCAGATTTGCGCAACTATTGC
CATAAGCAGGGTACTCAAACTGTTTGGTCATCTCAAAAATTGTGAATCCCAGGGCCTATG
GAACTGTATCATAAAATGACAATAATAATTATTTAAAAAATGAAGAAAAAGAAAAAAAAT
TACCCCCACAGATATGCTAATCCTCTGATGTCTACTGATCTGTCTCTCTGATTTTGTCAC
CTTGAGAGTGTTAGTAAGTGGAGTCATATTGTTTGTAACCCAAGGATTTCTGCCCCTCCT
CTTTCAGAACAATGGCTTTGAAATTCATGTAAATTGTTAGATTATAGTCTGTTTCATTTT
ATTGCTGAAAGGTACTTCACATATGGATGTACGTGTTCATGTTATATGTTCACATGGTGA
ACCAGTGTTTTGCTACTAGAAATGCCAATAAATGTGTTATAAATGTTTATGTACATATTT
CTGTGCAGTTTTAATTTTTCCAGTAGACAGATTCAATAGTATGATTCCTTTTTTCCCGCA
GGCTTGTCAAAGGAGGAGTGTTAAAATCAACAAAGATTTTGCAGTGAGGCATAATGATGG
AAATAAGTATTAAATATGTATTAAAATGATGAGAAACTAGGCTAACTGTCTTGCCTCCCA
TTGAGGCTGACTGAGATTGGTTACTGGTTCATTCTTACGACCAGTTGGGCTTCTTTTTAA
GGCACTGCTTGTGGTAGGTTCTATCTTCTCCTTGGACTTCAGTCATACTGTGATCAGTTA
TGGAAAGGAACTTTATCAGAGTCTTTTAAATGTTTAACACTTACAAGGATTCTTATATTT
TACTGCCGAGGCCTGGTCAGAGCCATTCACTGTCAGAGTAATGTGCTTGTTCGGATTCTT
GCAGGATCTGGTATGAATTTTCTAATTACTCTGAGTGGTAGATTGTCTTACTAGCTATAA
AGAGTTAATTATCCAACATGTTTATTAAGTCAGTAGATTAACAGTATTTTTCTAAAAAAA
GGACACTGAAATGAATAATTTTCAATCCTTCATTATAGACTACTATGAAAAAAAATTACC
TGGCCAGCTTTCTTTATTACATTTTACATTCTCTCTAAAAGTCATCACTTTTTTTTCCTA
AATGGCTTTGTTCTACCTTCATTACTATTGTTTTAGGTTTATTTGTAAGGCAGAGTGACA
GAGGGAGAGACGGGGAGATAGGAAGAGATCTTTCACCTGCTGGTTTGCTCCTCAAGTGAC
CGAGGTGGTTGGGACTGGAGCAGGCCCATGCTAGGAAACAGGAACTCTGGCTGTCCTTAG
TGGGTGGTAGTAGTCCAAGTACTTGACTTCCCACTCATATTAGCAGGGAACTGGAACAGA
ACTTGGGCAGTCGGGGCTTGAACTGATGCTCTGAAATGGGACCCAGCATCACAGGCAGTC
ACAAAATCTACTGCGTCACAGGACTGACCCTGTGCTACCTTTCAACTGTAATGGGAAATC
AGTGGTTTAATTAAACTAGTATGTTTAGTTTATTTTCAGGGTAACAAGGAAGAATTTATT
TTTTTATTTTGTACATTTTACATATCAGCTTGCTTTCAGGGTTTTTTCTAACTTGAGTTT
GTGTTTTGTTTTATGTTTTTTAGTGAGAATATTCTCTTTGGAATGGGCAATCCTCTTCTT
GACATCTCCGCTGTAGTGGACAAAGATTTTCTTGATAAGTGAGTATTAAACACTTCTTAT
ATACAGGATGGAATATACCTGTCAAAGGAAGTTGAATACGTTGGGACTGAATTTACTGTT
AACACCTCAGTTGCAAAAAAACATAAGGAATTTAAATCTGTTATAAGCAAATGTCATTAT
TGAACAATACACCATAATTTTATCAGGAAAGCATTTTTTAAAAAAGATTTACTCATTTAT
TTAAAAGAGTTACAAAGGGAAGGGAAATACAGAGAAAGGTCTTCCATCTCTGAGTCACTC
ACTGGATGGAGGCAACAACCAGAACTGGGCTGCACTGGGCTGAAGCCAGGAGCCAGGAGC
CAGGAGCTTTTTTCCAGGTCTTCTACAAGGCACAAGGGGCCCAAACATGTGGGCCGTCTT
CCATGCCTTTCCCAGGCATTAACAGAGAGCTGGATGAGAAACCAAGAAACTGGAAATCAA
ACTTGTGCCCATATGGCATGCCAGCATTAGAGGCAGTGGCTTTATTCTCAGTGCTACAAT
GCCAGCCCCAGGGAAAGCTTTCTTTTATTTGTGCCTATTATTCTTACTTATTTTTCTTGA
TATACTTTAGAAGGAGGAAGGGTATTTGGCTTAACAGTTAAACTCCCTTTTATTAAAAAA
AAATCAACTATTTATTTTAAAGAGCTACACAGAGAGAGACAGGCAGAGAAATAAGAGATC
TTCCATCTGCTGGTGCATTCCCCAAATGGTTGCAATGGCCAGGGTTGTGCCAAATTGAAG
GCAGGAGCTTCATCCGGGTTTCCCACATAATTGACGGGGGTCCAGGCACTTGGATCATCT
TCTGGTGCTTTTACCAGGAATATTAGCAGGGAGCTAGATTGAAAGTGGATTAGCTGGGAT
GTAAACCAGCACCCACGTAGTATATTGTCATCACAGATGGTGATTTTATTTACTATCCCA
TAGCAGTGGCTATGGTAGATAGTAAATTTTTAACTGTTATGTGTGTACTCTGTAATGATA
CCATAACATAAATTGAAGAAGAAAGCAAAGTGATTACAGAGGATAGGAAGAATTTGTACG
ATATAATTTAAAGGCCGGAAATCTTCATTATTTCCCTCTATTATTTTTTTTAAGATTTAT
TTTATATTTATTGGAAAGTCAGATATACAGAAAGGAGGAGAGACAGAGAGGAGAGACAGA
TCTTCCATCTGTTGATTCACTCCCCAAGCAGCTACAATGGCTGGAGCTGGAGCTGATCCA
AAAGCCAGGAACCCGGAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGCTTTCTGTTTTATA
TTCTCCTAATTCTAGGGCCCAGGAAGATCAGGTTTTTAAAAAATCAATGGTAATACTTAT
GTAAGCATAAAAATTATCTTTTAAAGACAGTTTTAAAGTACCCAATTCTCTAACCAACAG
TGCATTTCGCAGTTTTGGATGTTTGTCACTGGTATCTACTTTGAAAACTTGTGTGTTATT
CTTCTAAGAAACCCCTTACCTATTAAGCATTCACTATCTCCAGCTCTGATGTAGTACCAC
TTAACAAATATTCGTGTGTAACCTTTTGTGTGGAGGTCTGTTTCCGTTTCTCTTGGACAA
ACACAGAAAACGGATTTACTAGGTTGTATGGTAGTTCTGTGTTTTAACATTTTCAGGAAC
CACCAGAACTGTTAGGCACAGAAATTTCTTCATCATTTTATACTTTTTGTAGCAACTCAC
ACCCTTGGCCAAACTTGTGATTTTCCATTTAAAAAATTACAGTCATTTTAGTGAGTTTGC
AGTGTGATGCCGTTGTGTTTTTGTTTTCAAAAAAGTTTATTTTTTTGGGCCTGGCGGCTA
AGGTCCTCGCCTTGAACGCCCTGGGATCTCATATGGGTGCCGGTTCTAATCCCGGCAGCT
CCACTTCCCATCCAGCTCCCTGCTTGTGGCCTGGGAAAGCAGTTGAGGACGGCCCAAGGC
TTTGGGACCCTGCACCCGCGTGGGAGACCCGGAAGAGGTTCCAGGTTCCCGGCTTTGGAT
TGGCGCGCACCGGCCCGTTGCGGCTCACTTGGGGAGTGACTCATCGGACAGAAGATCTTC
CTCTCTGTCTCTCCTCCTCTGTGTATTTCTGACTGTAATAAAATGAATAAATCTTTAAAA
AAAAAAGTTTATTTTTGAGACAGAGGATTTGTGAGAAAATGACAGACACAGATCTTCCAT
TTGCTGGTTCATTTCTTTAGATGTTCTCATGTTTAAG
Chart Advanced