SelenoDB
Release 2.0
Chart Advanced
Sequence Report for SEQ00000746_2.0
Identity
SequenceIodothyronine deiodinase (DIO)
SpeciesEquus caballus (Horse)
DescriptionGenome -assembly-
Sequence IDSEQ00000746
Sequence release2.0
External IDNone
Gene SPG00000747_2.0
Annotation
Prediction method(s) None
OrientationForward
Toolbox
Sequence
>SEQ00000746_2.0 # Sequence # Iodothyronine deiodinase  (DIO) # Horse 
GAAGGCAGACGACAGGGCCAGGTCACACAGCAGGCAGCCGGGGCATCACTGCCCAGGCCT
TCTCCTCTCGTTGGCCCAGAGCCCCAGCCTCCTCCAACCCCAGGATGTTGCCAAAACACC
TCTGCTCCATCCAGGTCCTGCGGCCCCAACACGTTCTCCTGGCCTGGCTCCCAGGCTGCT
TAACCACCCCAGGGCCCCACCGTCAGCCTCCTTCCTGCCCTGCACTCCGGGAAGGGTGCC
CGGCCAGGGCCTGCCATGAGAAGACGGACAGAGACCTGCCATCTTGAGGACACATCCAAG
ACCAGACCACTGAGCCCTCTGCTACTGCCCTCCTGTGGGGTGTCCCCCATCCTGCCTAGC
CAAGCAGGAGGCGAGAGAGGTAGAAGGAAGTATGGAAAGAAGAAATCGTTCTTGAAGCAA
ACGAGAAGTGTGCACGCGTCTGCGCGAGGGCCCACGTGCCCGTGGGAGGACCTGCTTATC
CTGGAAGGAGACGGGCCGGCCCAGTGGCAGGGGCTGGACAGACTCATTAGACACCACACC
CGCAGGGGGCTTCCAGGGACTGGCTGCTTGGCCCTCACGTGGCCCAGCGGCTGACACCCC
CTACCTCACTCACTGCTGCCCGTGTGCAAAAGGGCAGAATGAAATGTCTTGAAATCCTCC
TGAAACAAGTTTCCAGTAAAGCCCACACTGCACCCATTTCCTCCTTTCACAAAGGTTTAT
TGGGCTCCGCCCGGCCGGGCTCAGGTTAGTCACTGCGGAGGATCGCGGGCTGGCCTGGGA
GGAGCAGGGCCAGAGCAGCAGAGGCGCAGACTGGCGTGACACACGCCCCTGCTGAGGCTG
CAGCAGCGGAGGGCACCAGAGGGCGCCGGAGGGCACGAGGGGAGGGCTGGGCCCAGGCAG
AGGTGAAGGCAGCAGATGAGGAGGAATCAGAGTTACCTGGGGAGGGAGAAGCGCAGAGGG
AACAGCAAGAGTGGAGGCTCAGAGGCAGGAAAGTGGCGGGGAATTCCCAGAGCATCAAGA
GGCCAGTGGAGGAGAAAGCGAGACAAGGGTCAGCGGCCAAGGAGGGCTGAGGCCCAGGCA
GCCAGGGCACCATGAGGCTGGGCAAGGGCACAGGCAGCACACACCTGCAGTTCTGCCACA
CTCTCCACCAGGTGTGAGGGCTGGCCCATCTCCTCCCGCAGGGGGGCCCAGCACCAACCT
CTCTGGGCTCCAGGAGTTGCTCTGCCAAGGAGATAGAGGCTATGCCCACCACACACCCAC
ACACCCAGCCCCACACAGGGCAATCCCAGGGAGGGGACAGAGCCTGGGCAAGCCCTCCCA
GCCCCGCCTTTCACAGGGAGACACCCCCTGAGGCTGGGCCGGGAAGCAGGCAGGCCGCCC
CTCCCCCAGGCTCCTGTCCCCTCCCCCAGCCCCTCTCTGAGTTGCTCCTGGACACCAAAT
GGACCCAGTTCAATTTGTCCTTCCTTTCCTTTCCTCTGCCCGCCCCCTGCTGGAGCTGTG
AGAGGAAAGGGGGCAGGCCTCACCAGGCCTGTGGCATGGGGACCAGCCCCAGCTCCCACT
CTGGTCTCCCCGGGGCAGAGCCTGCCAAGCCCACTGGGGCCAGGCCTCTAGGTGAGGACT
GGTGCTCCCCCAAGTTCTAGGGGGGTCTTGGCCTTAGGCCAAGCCTCTCACTGCTGACCC
CCAGGGACAGACAGGTCCAGACAGGATGGGCAGCTGGTGGGAAGGGCCAGGACTAAGGTG
GGAGGGTGGTTCTGCCCTAGAGATGGGGGACAGGGGCTGCTTGGGGAAGAGAGAGGGTTT
GGGAGAAAGAGAAGAGAGGGAGGCAGGAGCATGGTGGAGAGATGGAGTCTGCAGTGAGAG
TCACCAAGCCAGATCTGTGTCCCAGAGGCCAGGACCACCTGGACCTGGGGTCTGCCCTCA
CCTGCACAGATGGTCCTGAGCACCTTGACCGATGTTCTGGAATCCGGAGGTGTGGGGCGG
AGGCTGTCAGCCCAAACAGCAGAAGCAGATCCCCCAGAGCAGCTGGCGGCCCTAAGGACA
AGCGCGGCTCTCCTGAGCTCGGGCTGGAGGCAGCGTGGGCAGGTGCTGTTGGTGGGCCGC
ACCAGCAGAGGAGTAGAGGGGTCAGTCAGTCTCACAGCTGCCCAGACCACTCCTTCCACA
AACGCACAACCTCCACCGGACCCCAGGCAGCACGCAGGTTCTCCCAGCCCAAGGTGGCTT
TTTCATTCTCTGACACTAAATTTGGGAAGAGCAGGGGCGGGGCACAGCCGCATGGCTCTG
TCCCAGCTCCTGTGGGGGTGGGGGCAGGACGCTGGTCCTAGACTGGCACCCTCAGGAATC
AAGGAATCAGGGCCTGAGGGTTCCTCCAAAACAGCTGGTACTCCCTTTGCCCCTACCCAG
GAGGGGGCAACCCCAGGCCCCCAAACCTCCCCTCAAGAGACTTGCCAAGTAGGAGGTGGC
TCTCCCCAGACCCTCCCCCCAAATGAGAGGCAAGACAAGAAAACAATTTGCTAACTCAGA
GGTGCCCTGCGGGAGGGGGCAGACAAGTGGGACCTCCTCCCCCCTCCAGCCTGGTTTGAC
TCAGGGAGAACTCCCTAACCCACCTGAAAGACCCCTACCCAGCGGGGTGAGGGGCAATGA
GCGCGCTGAGAAGAGCGAGGCCCAGGCTGGCCTTCCTCTGCGGGGAGTTTCCGGGCTGGG
TAGCCCCCGGCGCCCCCGCCCCAGGCAGCAGAGAAATCGCCCACCGGGAGAAAGAAAGGG
GGCTGCTTAACGCCACCCCCGCCTTCCACTCAGCGTCTTGACCTGCTGGAGCCAGGGGTC
CAGCGGGAAGCTCACCGAGCAGAGGGTCCCGCCAGGCTGTGAAACCCGGAGGTGAGGACC
CCAGCACAAGGCGAGGCGTCTACCCCGGCGCCCGCTGGGTCGCGCTGGGTCCTGGGTGGG
GGCTCCTTGTCCTGCGGTTGACTTCTCCGGACTTGTTCCCTCGTCGCCGCCACCGCACCG
GACCGATTCGCCCTCGCCCTATCCCGGCCAAGCGAGCTCCCACTGCGGCCGGGACGCGAG
CGCTGTCTCCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAC
TTCCTGTGCATCCGCAAGCATTTCCTGAGCCGCCAGCGCCGGGGTGGGACCCGAACCTGA
AGTGGAGCTCAACTGTGATGGCGAGGAGGTGCCCCCCGACGACCCGCCTATCTGCGTGTC
CGACGACAACCGCCTGTGCACCTGGCGTCGCTGAAAGGCGGTGTGGTACGGCCAGAAGTT
GGATTTCTTCAAGCAGGCGCACGAGGGCGGTCCCGGCACCCAACTCCGAGGTGGTCCTGC
CCGACGGCTTCCAGAACCAGCATATCCTCGATTATGCGCGAGGAAACCGCCCGCTGGTGC
TCAATTTCGGCAGCTGCACCTGACCACCGTTCATGGCGCGCATGAGCGCCTTCCGGCGCC
TGGTCACCAAGTACCAGCGCGACGTCGACTTCCTCATCATCTACATCGAGGAAGCGCATC
CCTCCGACGGCTGGGTCACCACAGACTCCCCCTACATCATCCCGCAGCACCGAAGCCTGG
AGGACCGGGTCAGCGCAGCTCGGGTACTGCAGCAAGGAGCGCCCGGCTGCTCCCTTGTCC
TCGACACCATGGCCAACTCCAGCAGCTCAGCCTACGGCGCCTACTTCGAGCGCCTTTACG
TCATCCAAAGTGGCACCATTATGTACCAGGGCGGCCGCGGTCCAGACGGCTACCAGGTCT
CCGAGCTGCGCACCTGGCTGGAGCGCTATGATGAGCAGCTGCGCGGAGCTCAGCCCCGTT
GAGTGTAAACAACCAATGGACAATTGACTGAACTTGGCTGCCATGCCTTCGAGCCTTGGA
GGCCCACGTGCAAACACCCCAAACGAAGTCGAGCTTGGTGAGGGCCCAGTGACACAGATG
TGCTGCGTCACGGATCGCAGGCTGAGTCTGCACCCTCAGCCAAGCCACCTGAAGACTCTT
CCCCAGACTCTGCTTCTGTGACTGTCCTTCGCCTGTACCTCCCTGGCTCGCTCTAAACCC
CCTGCTGAGTGCAGATGTGGCGACAGCTTTGCCGTGTGCCCCTGGACTTGCCCCCACAGA
GGCCCCTGCCGTGCTGTCTCACACCCCTCCCCCAGAGAGAAGAGCCAGCGAGCCTTTAGC
CAGGCGCAGCGGCCCCGCACAAAGAGACTTTGGCTGCGCCCGCGCCCTGAGCGCAGCTGG
GTTCCAGCAGCGTGTGCGCCGCTCGCCCTAGTTGCCTGGCACCCACACCTGTCGCGCGCC
GGGAGAGGATGCCCTGCTGCTTTTGTGTCTGTTTCTTGTCCCTGAGTTGGGGGAGGGGGC
TTGGGATGGGGAAGGGTGGGCAGGGTTATTTTCCCCCCTTATTTTGGGTGCTCTCGAGCC
CCACTGCTGATGACGAACTGACTCTAACTGGTCTTGACCACGAGCTGGTTCTGAATTGCA
GGGGGCTCGCAGCAGTGCCTAAAGGGAGAGGGGGGAAAGTGCTCTGGGATTCCGTGAGGA
ATCCAGCAGAAACGGGGTGGGGGTGGGGGGGTTCGGGACCAGAGGGAAGAAGACTGGAGA
GGCATTGGCGAGGTTCGCAGCGCCCCACGGGAGAGGAGAGGAGGGCTGGGGCTCCTGGGG
AACCGGGTTTTGGGGTGGCGGAGTCGGGGGAAAGGAAGATGGGGGGGAGAGCTTGGGGGA
CCCCGAGGTGAGAGGCGCTCTCTAGCTAGAACTGCCCAGTTGGGGAGCTTAGNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGGC
CAGGAATCTGGCTAGGTAGAGCTGCGCTCCGCCACCGCAGCGCTCTGCACAACCTGGCTT
CTCCCTCCCCACTTCCCGCACCTGCAAAATTGTCTTCCCCCACCTTCCGCAAGCCCTGCC
TCGCTGCTGGGGTCTGCGGGAGGCGCACAGCGCAGGGTGGCGGAGGGAGGGGTGACGGCG
GAGGGAAGGCGGGCATGCACCGCCGTCACTCCAGCAGCAGCTCCTACTGCGAGGCGGGGA
TGGCACGGAGTGCGCCCCCCGCCCGAGACTCCCCTCCTCCTGCCCCTCCTTGGCTTCTCC
AAATTCGAACCAAACCTCACCACCACCCCCAACGTGCTGGGGGCTGGGAAGTGGAGAAGG
GGAGCGAGGTGGATGAGCCAAGACACACTAGAAAGAGAGGGATGGCCGCTGGCGGGACGG
GGGGCTGGGGGAGGAAGGGGTCGTGGCGTTTGGCACAGATCGCCGCCTGTAGTCAAGACC
AGGCGCTCCCACGCAATCCCCGCCCTCACTCCCTCCCCGGCTTCTCCCTGGCTGAGGGCG
ACGCCAGGAGCACGGGGTTGGCGCGGCCCCCACCTCCCTCTGCTAATGACACCTTGAGCG
GAAAAGTGGGCAAGGGGAGACAGAGGAAAGAGCACTGAGGCGGGAGTCCGCAGATTGGGA
GTGGGGGGAGCGGGAGCACCCGAACTTCCCCGGCCCGGCCACCCAGGCCCATCGGCGTCC
CAGGATGGGAGTGGAGTGAGTGTCGGGGAGCCCCCGGGCGTGACGGCGCGCGCACGGGAG
AGGAGAGGATTTGCGTGGGCGAGTGGGGGCGCAGCATGCAGGGTGGGAGAGAGTGGACCT
TACCCCACCTACACCGTCCCCAATTCCGCGCCCGGCCCCCACGCTGCTCCTCCTTGAAAA
CTTTTTGGAATTGACACTCAGCTTGGGGAATTTTTGTTTGTTTGTTTTAAAAGTATTTAA
ATTGAAAAATAACTTTTAAGAAAAAATTGGTACAACTGGTATTTCTGCATCTCCTCCTCT
ACCCCTCCTCCCGCGCCCTTCTCTCCCTGAAACCCCCAGGAAGAATCCTGAGCAAGCAGC
CCAGACAAGGCTAGGCACCGAGAAGGGCCCGCCCTGAGCTCCGGCCCTCACTGGCCCGGG
TAGGAGCTTGGTGGCGTGCTCAGGCTGCTTCCAGTCGTGGCCTGCCCCTTGGGGGTCTAG
TTGGATACGCTGAGCGACCTCCCCTCCCCGCGGAGCCTGCGCCCCCTCGGCCTCCTGGAG
CTTCCCGGAAGAAAGCCTGAGTGCTCGAGTGCTCGGTGCTTCTCCTGCCCCTGCCCACAC
GGCCGGCCGGCGCGCGCGCTCCACTGGAGTTCGGGCATCCCCTCTTTTTCCTTCTTTCTC
TTCTGCTCCCTCCCTCCCTTCCTCCCCTTCATCTTCTGTTTCTCTCTCTTCCCGTTCCCT
CCTTCTTTTCTTGTTTCTACTTTTCCTCTCTTTTCCTTTAAAATCTCTTCTTATAAAAGT
AGTGCGCGCTCATTGCAGAAAACACAGAAAAGTCCTGAGAAGAAAATAAAACCAACCCCA
GGTAACCTCCTGGTGTGTGCACTTTCAAACTTGCCTCATACTCCGCACTTGTAAAGATGC
ATTTTAAAAACAAGAGAGAGACCATCCTTTTGAAACCTCACGTTAACTTTTGACTCGTGG
GTATCCTCTTTCCACGTCCATAAATGTCTTGAATGGCACCACTGCCACATTGTCAAATGG
ACAACCAGAGATCACTCCACGGGCACTCCAGGTGTGAGAGGTGTTTCTTTATTACACACA
TTATTCTTATTGTTATCCGATGAGTAGTCTGTGCACATCACATGGCTCACACCCCCCCCA
GCACATTTCTTGAAGTGAAATTGCCAGGTCAAGACACGTGCAAGTCTTTAAAGATGTCTG
TTTGCCACATTTTGCTAAACTGCCTTGCAGAAAGTCAATTTAATTTCATTGTTTTGTATT
CTCCCAGTCCTCTCTCTCTCTCTTCTTTATTTTTACTTGAAGTATATGAATATAATACAT
AAATCCATTTTCAACATTAAATTTTAAATACAGAAGAACCTAGAGCAGAAAGTGCCACCC
TCCCTTGGAGCAGGATTTTTCAAACTGCACTTCAGGACGCAGCAGGGGGTCAGGAAATTA
ATTAGATCAAGTTGAGCATTTTGAAGAACTGAAATAGAATAAATACAATGTAAATACCAG
TATACATTTCACCTAGAGTAACCATAGTTTCCTGAGACTTTTGTTTCAATTGTGTGTGTG
GATGCATGTACAAGGTGGTTGATGTGAAATGTATTTCTCCTGAAGGATCAAAACGTTTGG
AAATGTTTGAAAGCCACCCCTGGAGTGTCCCTCAACTGGGATGGCCCCTGCAAACTGTTG
GGTGTTTGCTTCCGGACTCTCCTTCATCTGCTGACAGTGTGTGAGAACGTTCTCAGATAT
AGTTCTGAGTGAGGAGCGTGCTGCAGTGTTTGATGATTGCCCTCACCCACCCCCACTCAC
TTTCTCCTGCCATTCTCTATCCCCCACCCCTCGCCCTCCATACATCTAGTCTGAGCAGGT
CTCTGTCTGCAGGCTTACTTGTGCCAGGCACGTATGGATGCCTGAGCACCCCACCCCCCA
CCTCTAGGAGGAACTCGTCTCTGCTCTCAAGGAATGCTGGGATCAGTGGGGAGGAGGCGT
GAGCAGCCATTATTCTTGTGGTTACCGTCAGGGTCATCCTCGTCACTGGTGCTTTCAAGG
TCTTCCCTCAGTTTAGGACACAGTTTAGTTTTAGGCAGGGAGAGGGAGGACGTTAAAAGA
GTTCATAGAGAAGGTCTTATTTGCTGCTTGAAGGCGCAAGCGCTTCTTCCAGGAGGACAT
GGAAGGAAGGGCATCCTTGGCAGAGGGCACTGGCAGTGGAAAGCCGGGCAGGCCCAAAAG
GGCAGGTTGTGTTCAGAGAGTCCGGAGGCCCCAGTGTGACTGCAAAGCAGGAGGGTAGGG
AGGAGGAGGGGGAGGAGGAGGAGAGGCCAGAGGAGCTTCGGGGCCAGCTTGGGGGCTTGG
GCATCAGCCTGAGGTCTCTGCTGAGCCGCAGGGATGGGAGCCTCAGACAGGAAATGGGGG
AAGTCAGGGGGAGAGGGGAAGGAGCGTCAGATGCCTGGGGATGGGGGTAGATGGGCATGT
CCACCATCCACCACTGACGGGGACAGGTGCACTTCCAAGGGGCAGGCTGGCATCTCCACC
TTTGACCTAGCAACTGTCGTCTAGTATTTACGTGAAGGAAATAAACTATTGGACAAAGAG
GTGGGAAGCTACCCAGAGGTCCATGGCCTCCCCTTTACATTATCCAGACACCCATTGCAG
AGAAGTCACATCCCAAAACTGTGGGGCTGCCTACACCTGGAAGAGTGAGAAGTGACATCT
GAGTGTTGGCTCCAGGGGCCAGGCACCAGGCAAAGTGCATTCTCAG
Chart Advanced