SelenoDB
Release 2.0
Chart Advanced
Sequence Report for SEQ00000616_2.0
Identity
SequenceGlutathione peroxidase 7 (GPx7)
SpeciesDipodomys ordii (Kangaroo rat)
DescriptionGenome -assembly-
Sequence IDSEQ00000616
Sequence release2.0
External IDNone
Gene SPG00000617_2.0
Annotation
Prediction method(s) None
OrientationReverse
Toolbox Forward Reverse  
Sequence
>SEQ00000616_2.0 # Sequence # Glutathione peroxidase 7 (GPx7) # Kangaroo rat 
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGACTTTC
CTGCCCAGGGCTGGCTTTGAACTTCGATCCTCAGATCTCAGCCTCCAGAGTTGGAATCAG
TAGAAAGTTAACAAAGTCTACAAGAATTTAGGTCTAATTGAGAATATAAAATCCTCAATT
ATCCTGGAAGGGCCTGGGAAAATAGTTTGCTCATTTTTACTGTTCAGATAGGGTTTAGTC
AGGGACAGGCATGGAGCTGGTACTCAGAGTGCTTACTGTGTAATCCAGTTTAATCTGGAG
GGGAGGGAAGGGCAATTGCTTCAACAGTGACAGTATATAATGAGTGAGTGAGTGAATCAG
TCAGAGAGCAAACTGTGACAGCAAAGCTTAAGGGAGGCACAAAGGCTAGGTGGCTAGGAC
AACAGATAACGTTAGCATGAATAGTTCAGTTTTGGATTGCTGAATTAATGAGATGCTCAC
TAGGCAGGTGGATTTGTGTCCAGCATAGATACAATGTGGGGGTTTTGAGTGTCATCAGGG
TAATAAGATAGTGGTCAAAACTATGAGAAAAAAAATGTGGTGAGGGGCTGGGAAGGTGGC
TCAGTGGTAGAGCGCTTGCCTTGCATGCCTGAGGCCCTGGGTTCGATTCCTCAGCACCAC
ATAAGCAGGAAAAAAAAGCCGGAAGTGGCGCTGTGGCTCAAGTAGTAGAGCGCTAGCCTT
GAGCTGAAGAGCTGAAGGACAGCGCCCAGGCCCAGAGTTCAGGCCCATGACTGGACCCCA
AAAAAAAAATGTGGTGATTACAGATAAACATATGAAGTAGGAAAAGAGAGCCACCTAGAA
CCCCAAGGAAGACCAGCAGGGAAGGGGTAAGTAGGAAGAGACATCAGCAGAGACTTGAGA
TGAATGAAGCACTCTGAGACATAGGAGGGAAACTATGGTAGGAAACTCAATGGAGGAGAA
TTTGTCATGAAGAGCTTGGTCAGCAATGTCACAAATGGTTGAGAGGTCAAGTAAAATAAG
ATCAGAGAGATGTTCTATTAGATTCAACAATACGGAGCTAAGTAATTGTGAGTAAAGTAA
GGTATAAATATGGATGGTAGACAAGGAAGCAGCCCAGGAGAATGTGGTTCTGAGATGCTA
CTATGAAAATGTTTGTGATTCAAACTGTATAGCCCATGATNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNAAAAGAAACTCAGGGACATGGGTTGGGAAGGTGGCTCAGTGGTAGAGTGCCTTGCTTC
ACATGTATGAGGCCCTGGGTTCGAATTCTCAGAAACCACATAAATAGATAAAGCTGGGAA
GTGGCACTGTGGCTCAAGTGGTAAAGTAGTAGCCTTGAGCTGAAGAGCACAGGGACAGTG
CCCAAACCAGGAGTTCAAGCCCCACGACCAGAAAAAAAAAAAAAAAAAAACAGCTCAGGG
ACAGCGCCCAGCTTTGAATTAAAGTCCTAGGACTGGTGGGCATGCACATGTGTGTGTGTG
TGTGCACATACACACAGACGACTAGAAGAGGAAAACAACAAACATAAATTTGATCTGGAT
TTCCATTGGCTGAAAATTCATACTGAATGCAAGTTTTCATTGATCACAAGTAATTTTTTG
GTTAATATGCAAAAACATTTATTGAATATTTTCTATTTGGCTTGTATTACTTAAGGCACT
TTTACATATATCTCATCACAACCCTTCTAAGAGCCCTGTGAGGTAGGAATCAGTCCCATT
TTACAGAGACCTGGCCAAGGACGAGATTATTGCTTTATATCCTCTGCCTGTCACATGTCC
CCATTGGCTAGAGGTTTTTATTAGCTGGTGATTCACCATCAAAAGAAGTTTCAGTGGCCA
GTAGTAATTCCTATCAGTTGCTCTGGTTCAAATAATCAAAATGCTAGAAAATTTTCCCCG
TAGGAGTGATAGAGATGGTAAGAGGACCAGTAGATCTGTCACTGGGAAGCACCACTTGTT
TGTTCTGGTCACCTATACAAGGTGATGGGGAAGGGAGGGGACAGGGAATTTGGTCATAAG
TCTTCTCGCTTCTTCAGAATGAGCTTCGCCACTAGGCTTGTGATATGAGGCCTGATTTCC
TCCACAGACACAGTCGGGTCCCATGCTCCTACCACCTTTCCATCTGGGGCTACGAGGTAC
TTCCAGAAGTTCCAGGTGGGCTCTTTTCCAGAAGTATCTTAAAAAAAGGAGGGAAAACAA
AGTGTGCTTCTCTGTGTAATTCCACTATCAGTATAACACCGATACCCATCCACACCCCAG
AACCACTGAGAATAAGACTCAGGTATTAATATTTTTCAAAAGCTCTCCAAGAGGCCCCAG
TGTGAAATCAAAGATGAGCTTTAGAATTCTGTGATATGCCTGATAAAGAATGCTTTCCAG
CCGGGCGCTGGTGGCTCACGCCTGTAAAGGAGGCTGAGATCTGAGGATCGCAGTTTAAAG
CCAGCCCGGGCAAAGAGAGACCGTGAGACTCCTATCTCCAATAAACCACCAGAAAACCGG
AAGTGGCGCTGTAGCTCAAGTGGTAGAGCGCTTGCCTTGAGCTGAAGAGCTGAGGGACAG
CGCCCAGGCCCAGAGTTCAAGCCCCACGACTGACAAAAAAAAAAAAAGAGTTTCATGGCT
TTTCCTGCCTGGGCTGGCTTTGAATAGCAATCCTCAGATTTCAGCCACCTGAGTAGCTAG
GATTACAGTCATGAGCCACTGGCACCAGGCTTCTGTGAGACCCTCACTCTCATTTTGTGG
TTCTCAGGCTACTAGGGCTAGATATGGTAACTATTTCTGAAACATTGAGATCTAGTATTT
TAGCTTAGGTTTCCCTTCCCTGGCATCAAGAGACTGCTTCTGGCTCAGGACAGGAGATGT
TAGCCTGCTCAAGATAGATGGCATCCCCAACCAAATCTGTGTCTTGGTTTCTCCATCTTA
AGAAGTCCAAGAATTCAACTAATCTCTATTGACTGAACATTATACCAGTCTCCTTTCAAG
AACCCCTGCAGGTGAAACACAATCCCAAGGAAGTCCTTAGGTTGTAGGAGAACTTGGAGG
CAGCAGGTGTGGAGATATTCTTATGCAGGAATTCCTCTGGACTCAAACTTACCCCTTCTT
TCCTCCAAGATTAGTGCTAGAATAACACATCAATCCACCAGAGAGGGTCAGGAAGGGAAA
AGTTAACCAGCTAGCCAGTGGCTCCTGCCCAGGGAGCCATAGCCTCCACCAGCTGATGGA
AGATAAGGACAAGAAGGGCTAGGACTCACAGGTCAGATACTTGAAGGCAGGATGGGCACC
AGTGCCAATGACTGCGACCTTACTAAACATGGGGAAAGATACACTGTAGGTGCGGCGAGC
AAAGCTCTCAATCTCCCTGTTGCTGTCTGGCTCCTGCTGGCCAAACTGGTTGCAGGGAAA
GGCAAGCACGTTGAAGTGGTAGGGTCCTAGATCCCGCTGCAGCTGCTGCAGTGCTCGGTA
GTGCTGGTCTGTAAAGCCACACTCACTAGCCACGTTCACCACCAGAGATACCTGCATGGT
AAAAAAAAACAAAAACACAAAACAAAAACAACAACAAAAAACAAATCCCAGATATATACC
CAGCCCCGTATATGCATGTGCTCCCCCAAGAATCAACATTCCCTCATACATGCAAAAATA
CTAAGAACATATGAAAGTGTGTGCAATGTTCTCATACATACCGAAACACATACACACTGG
CACATAAATTAGCATGAAGTTGCTTAGAGATGTGTGCACACATAATGAACATCTGTAAGT
GTAAGTATACAATGAATACTCATAAATGGATATTCATGTTCTATGACTCAAACATATATT
AGCCAGTACAAATACACACTGTGCAGTCATGGGAAGGTGATGTGAGGGAGGGGAAAGGCA
ACACCCCATTCCTTTTTTGGCTCAGTCAGCTAGCATTCCATCCACAATACTGTAGTTGCT
TGTATATGGTTGATCTGCCTTCTAGAATGGGAACATACTGAGGGCAAGAGCTATGTCCAT
GATATCTCTGGGGAAAACTAAATGAGTGTGCAGTATTCTTAAATACCTACATGAGTACCT
AAACAGACTTAGTGGATTTTTTTTTTGATAAAATGATCATTATGACCCTAGGGCAATCTT
TTTTTTGTTCTTTTCCATCTTTCTCTGATTACTGATCACTAATTTTATTCAAGGCTTTGG
GCAACACATATAAGGCTAGTTGATATCAGTAGGTTATACTACTGCAATCAAATTTTTGGC
ACCAATGGATACATTTTTTAGCTGCTAACTCTATATCATTAGAGGATAAGAAGCCCTACC
CTGTGCCTGGGAAGCCTAGCCTTAAATTCCAGGCTGCTCTTTGAGAAGAGTCAGGAAAAG
GGATAGGATAGTCTTGAGCACTGGACACAAATTTCTCAGACTAGATAGGTTTGTCTCAAC
CTTAGCACTATTGATACTATGAGCAAACAGTTCTTTGTTATGGGGAAGTGGGGCTGTCCT
ATTTGTTGTAGGATATTTAGCAGCATCATTGGCCTCTACCCATTAGATGCTTAGTCTTAA
AAATCAAAAATGTTTAAAAAAGCCAGGTGTGATGATGCATGCCTGGAGTCAAAACACTTG
GAAGGCTAATGCAGAAGGACTGTTTCAAGCAAGCCTGTGTGACAAAGAGATCTTGTCTTA
AAAAAGAGTCTCAGGGCTGGAAAGTGACTCAGTGGTAAGCGCTTGCCTTGCATGCCTGAG
GNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGACAGCGGTGCTCCCCTCCCCCTTCTCCCCTCCCCCGC
CAGGCCCCAGCCCGGCAGCCGCGCGCCAGGCCGCGGCGGTGCGGCACTCACCGAGCCCCG
GTACTTCTCCAGCGACACCAGCTTGCCCCGGATGTTGACCACCTGGAAGTCGTAGAAGTC
CGGCTCCCGCCGCGCGCAGGCCGCGCCCCACAGCAGCAGCCACGCCGCCGCCGCCGCCAC
CACCACGGCCGCCGCCATGACTCGCTCCCGAGGCCTCGCCTCGCCGGGATGGGGGGCACC
GGCGTCGGGGGGCGGGAGGGGGCGGCCCGCGAGGCTGGACGCGCCCCCTTTGCCCGCGCT
CCGCCGGCGGTGGAGCTCCGGGCGCGGGTATTTCTGTTTCCCCAGATGTCCTGCGGGTAT
GCACGGCCCTGTTGGCCCGGCCTCCGACCCCCACGCCCCCCAGCCATGATGTCAGGATTC
TGGGCACCAAGCAGAGAGCTGGCATCAGTGAGTCTCCCCCTCACTCGGGGAGAGCCCACA
CTAGTAAAGAGCCAAAGACAAAAATCTGAGCCTGAGTGGAAGTTGTCGTTAGTGTCTGGC
CCTGCAGCAGGCAACTCCACCATCCCAGGCCTCAGTTTCTCCGCTCAGGTAGTAGACTAC
CCCTTGCCATCCACCTAAGTCCCTGTCGGTGGGAATGCTGTACCAGGACAGAAAAATGGA
TGCGGCACATGTGAACAATTAACAAACTGAGGTGCATGAATGATGTTTCCTGAAAGTAAC
AGCTGGGAGAAGGCTGCTGCTGCAGGTTGGGCCTGGAGATTGGAATACAGGAGGTTTAGG
AGGAAGCACCCTTAGGATCAGTAGCAGGGAGGGAACACAGGTGGCAGAGAGAGAAGTGGA
GAGCTCAGGCAGGACTAAAGGCGACTCACCCAACAGGGCTGCAAGCTAAAATGGTCCATC
AAAGTTGTTTGCAGATGAGCTAAGGTGGCCAGGCCTTTGTTCCTCAGTCCTCCTCAGTCA
CTAAATACAGGGCTAGGTGGGAAGACATAGCAGAGCCAAGAAGATCCAGTATTGACTGTT
AAAGACTGTATGAGAAAAGTACTTCCCAGGAGCTGTTGTTACTAGTCTACAAAGACAAAA
TTAGAGTGTTACATCACAGAGTTTTCCAGGCTCTAGAAAACAATATTGAATCTCATAAAG
AGCCAGGCATGAGGCTAGATCCTCCAGGAACTCACATCATTATATGAGGAAGCAGGCAGA
CTGGAGATTTAGAATATTGTGATCATCTCTCTCTCTGTTTCTGTCTCTCTGCTGGTTCTG
AGACTTGAACTCAGGGCCTGTGTAATCTCCTTGAGCTTTTTGTGCTCAAGGCTAGAACTC
TTATCATTTGAGCCACAAATACACTTCTAGATCTCTTAGTGTTTATTTGAAGAGTCTCAC
AGACTTTCCTGCCCAGGTTGGCTTTGAACTGTGATCTTCAGATCTCAGCCTCCTGAATAG
CTAGGATTACAGGTTTAAGCCATCAGTGCTGTCACTGGACGCAGATAGAGGTTTGTGCCT
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNN
Chart Advanced