SelenoDB
Release 2.0
Chart Advanced
Transcript Report for SPT00003110_2.0
Identity
TranscriptIodothyronine deiodinase 2 (DIO2)
SpeciesHomo sapiens ssp. Denisova (Denisovan)
Transcript IDSPT00003110
Transcript release2.0
External ID None
Gene SPG00002890_2.0
Annotation
Prediction method(s)
Curated external database annotation (Ensembl, 38) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Full length Spliced 5UTR CDS 3UTR
Forward Reverse  
SNP (Present-day Humans) Fixed differences to present-day humans
Sequence
>SPT00003110_2.0 # Transcript # Iodothyronine deiodinase 2 (DIO2) # Denisovan 
AATAGGGCTCTGTTGAAATATGGATTCAGTTCTTAATTTCCTTGCCTTTATATAACTTTT
TAAAACAATAAGCTCTCTTATAATCATACCTTTAACCAGCTAATCTAGTTTTCTTTCATC
TCTTGCTGAAATTCTTCTCCAGCCAATGCCGGACTTCTTGAAGGTTGTAGGAGAAGGGGC
CCTTTCCTCCCAGATAAGCAATTTTCTGTCTCTGCACAATgCACACACGTTCAAAGGCTA
CCCcgTAAGCTATGTTGGCGTTATTGTCCATGCgGTCAGCCACAACTCGGCACTGGGGCG
GCAAGGAGAAACGCTCCAGAAGCTGCTGGGCTGCTGCACATCGATCTTCCTGGTTCTGGT
GCTTCTTCACCTCAAAAGACAAAGAGGAGTCCCCCGGTATCGCCCAGCCATCTGATGGAT
GAGCCTCATCAATGTAGACCAGCAGGAAGTCAGCCACTGAGGAGAACTCTTCCACCAGTT
TGCGGAAGGCTGGCAGCTGGCTCGTGAAAGGAGGTCAAGTGGCTGAGCCAAAGTTGACCA
CTAGTGGGCGCTCAGGGCTGGCAAAGTCAAGAAGGTGGCATGTGGCTCCCTCAGCTATCT
TCTCCTGGGTACCATTGCCACTGTTGTCACCTCCTTCTGCACTGGAGACATGCACCACAC
TGGAATTGGGGGCATCCTCACCCAATTTCACCTGACGGTAAAAAAAAAAAAAAAGAAGAA
GAAGAAGAAGGTGAGAATATCACATTAAACACATTGCCACTTGAATTCACATTAAATAGT
TACAATTGGCTCTAATAGAGTGTGGTATTTCCTTCAGAGCATTTGGTAAACATTTATTGA
TTTGAGTAAAGAGGCATGATGGCAGGTAATGTAAAGAATGGCCCAAAAGACAATAAAAGT
CTTTTTCATTCTGTATAGTCACTGAAGATAATTATTTTCATCACTGAAGGCACTGGAGTT
AACTCTTTTTAAAATTAAGCCAAGGCTGGTATTCTTTACTATCCTTATTTTGCTGTCAAT
TCTTAACATGCATTCTATAACAAATGATTAATTGACTTCATTTTAAAAATTAGAAGCAAA
TGGTCTACTTTAAGACAAATTATCAGGGTCTTGGGACATGGTCCCTCTTTCTGAATTCTG
AAACACCAGGCAGGACCTTCATTTTCTTGCATGATACTAAGTCATTTAATCTCAACCAAT
GGCCAGTGATACCAGTGGGCTCTATTCTTGGCCAGATCTAGAAAACCTGAGGTCTACCAC
TTATAagAAGTGTTACTTCCACTTAACCTCTTTAGTGATTCAGCTTTCCCACCTGTAAAA
TGGAAATAATAATGCCTGTCTTCCACATATGGCAACTGGAGGACAACATGAGAAAAAGAG
CTCTTTGTGCACTGTAACTCTATGGGTGTGTGTTGTCCTTATCAGATGCTACCCCACCAT
GTGAAACAGAACATCATCATTCTTGGGCAATTCTGTGTTTGTTTTTGTTTTTTTAAATGC
CCTGAGCAAAGCTTTGCACTCTCCTCAATATGGCATCCTCCCTGGAGGCTTCTACTGCCA
CTGCTTACAAGGTGGTTCTTACCACTCCAATCTTACAATTTCCATTTAAAAAAAAAATAA
AAACAGACAAAAAAACAAAAATGGTTACTCCAGAATTCTACTTTAAGTCAATTTCTCATT
TTCCATGTGTGCTTGTTTCCTTCTTTTTATCTAGGAAGTCACATTAAAAAGTACTTTTCT
ACCCCACAATTTGTTAACAAGCTCCTCTGAATTATAAAATATTGGGGCAGAAGAGGTAGA
GATAAAAATTGTTTCATGTGCTCCCTTTGCACATGGTTTAAATAGTTGAGAACAGAATGA
AGGAAAGTTTGCAGCCTTTGAATCTGTAAATTGATCATAAAAAGCAGGCAACAATAAAAG
AGCCAATTACTTCAGTTTGAATTAATACGATTGGATCTTCCTTAGAATGGTTTAATCAAA
gCCAATAACATTAGGGACAATTTAGGGACAGTACAATTGATTTTTATATACTATCCTTAA
TATTACAATATACTTCCAACTGGGTTGACTTATTTCCCTCATATACATACAGCCACACAT
AATGCTACTGTTAATTGAAGTCACTTCGAAGTGAATTGTTAAAGATGTAACAATCCAAAC
TGATATAACCCACTCAAGGGCTTTTATTCAGAAGCTTCTATCTAATGTTAATGCATAACT
CATTTTAACTGTAGAGAAAGAATTAAAGTTCTTTCTCTCCCTTCTGAAAAATCCTAGCAG
GGAAGGTTTGAAATAAGCATTATTAGTGTTCTAAGAGAAATCTTACTGTAATAATCTTCC
TTCTCAGAAAGGAAGCTGCTGGTGTGATTTAAGTAAGTACATTTGTTTTTTAGTCACCAC
CACAGAGAAAATTATTTTACTTATACTAACTTTCTTGATTAATTTGCAAATGACACTAGA
TGGAGAAATCTAATAAGCACATTTAGTTGGATTCTTTCATATGAACTACCCTAGTCTTTA
AGGCATGAAAATATACATCAAATTTAAAGATATGTTGAAGGTATTATTAACCTTTTAAGC
CGTGAGTTCTTTTTGTACTTCTTTTTTTTTTATAGATCTAGGTAGTGGGTAGCAGTCTCT
TCTCTTTAGATCTTTCCCATTTGAAATAATAGTAATGATTCTAGAAGGGGTGTTTTAACA
ATATCATGTGTACTGTGTGCCTCAACgTACCGTGATAAGAAGACCTAAATGCATTCAGAT
TAGTCCGTTGTAGGGACTTCCTGTTAAGTAAGCAACCTGTACACTTGTAGGTTCTTGATA
GGTAAAAACATTCATCTGCATTTTGGAATCATTTTTGAAACCCATGAACAATTATGTGGC
CTTGACAAATGCGCCTCTAACCCCCTGATTCATCCGAGCAGACCTGTTGATCCTTTCATT
ATGTCTGATTATTCAACTGAATAATCTAATCTGTTGCTTTAGTCACAGGGGACTCTCTTA
TTACCTGCAGTAAATTTTCTTGGAAAGTTAAGGCACCTTCTCCTTCTTAGAAACAATGTA
TAGTTCAGCTGCAGAATTCTTTCCAAAACACAGACTAATTTGCCTTGGGAAATTTAGAGT
AAGTACAACACTGTCAGTCTAAAATAAAAAAATTAGGAAAGTTACCAAATTCGTAATGCT
CTTTATGGGGGGGATTTAGCATTTTGTTAGGATTAGGGTTAGACTGGGAAGTATTTATTT
TATTGAATGAATGCTAGTTGTTATAATCCTAGGTCAGTGAAGAATTTTACACTTAATGAT
AACCCTGACCTGCAATGAACATAATCATATTTGGGTGATGGATAAGCTCACTGAGGCAGA
TAAATTTAGAAATATGAATCCTGGGGCCCTCTCATAGAGTACTACCAAAATCAGCACTCA
ATGTTATTGATCTGTCCTTGACAGTCTCATCTGGTCAGTGCACAAAACAAATGTGGCCTA
TTATTTTTATTTTGTTGAGGAGCCAGGGTCCCTTACTGAATGTTATAATGTCATAAATGG
ATATGCTTATTCATGAAGGTGCCTAGGCAAGAGAAAATGCATAGATAAAATTAATATTAT
TAATAAAACTAAGAAGGAAAAACACACACCCACCATCCATAAATCCAAATGTGAGTAGAC
CAGTAGTCTGCTTTTATAAGCTTCATATACTAGTCATAAAATGTGTCCATCTTTGCTAAA
ACCTGATGGAGGACAATTTAGCTAAAATAAAGAAAAAAAACTTTTTTTAGATATGGAAGT
TTCCTTTAACCTAAAAGAAAATATTCTAAAAGGATATTACTGTTCATTCTCATCTCCCCA
TTTGGTCACCATAAAAATTAAATTCCTAATAGACCAGAGTTTCAAATGGAGAACTTCTTG
GTTTGCTGGGTTATGCACCCTGCTGAGACAGGCTGGGAGAATCACCATTGTCTTCGATGA
TGGAAGATTCTTTGCTCTCCCCACGAGCAAAGCATTCCTTGACACAGAGCCAAAATGATG
AAGAAAATAAAGTTGGTCCCATAATAACATTTAGGCTGCAGGAAAGAAGCTCAACAAAAA
CAAGTTATCCCCTGGTACTCCCAAACTTTGTTTTAATTTCCCACAGTGGCACAGAAAGTC
TGGCCACAAGTTACCTATCATCTTAATTTCTCCTTCTTAGAGGGTTTGTGTTTGGTTTTT
GTCCTTAATGAGACATATTTGCCAAAGAGGCATTCAAAAGGCATTTTTTACTCTTGCGGA
AGAGTAATTAGGTCGGTACCTCTTTCCCTGCCAGCATTAGCCGCTCTAAAGAGAACCCTG
CCCAGTATTTAATGCCCAAACACAAGAAGCATCATTTCCACTAATTGGTCTTGAAGTTCC
GATGTTCCCAAAGGGTCCCTTTATTTTGCAAGGATCAGAAAGGACATACGTAAAATGTGA
TATTGTCATCGCTGACTTTTATCTCTCTCATCTGCACTATTACAGTGGTCCTCTCTTATG
TTTTTGCAAGCAACATCAACACAACACCAACAAAGGAGGTAAATAAAGGATTTGCATTTT
TACAACAGAAGACATCTCCGGGCCAAGTTCAAATGTTGGAATGGAAATCTTTATAAATAT
GAACATGAACATAAACATATAGCATATATAAAAATTTGATTCCCTTGATGATGTTCAGTG
TTCAGTGCATGGGGAAAAAGGAAATGCTGCTTTAGCATGTGGACTGTGAAATGCAGGACA
AGGGGGAGAAAAGAACCATTCATCAAGTAGAAGCAGAAAATACAGCATATACTACTAACC
TTGTTTCTTGTTTTGGGATTTTATTTCTTTTTCTTTTCCACAGCCTGAGAAAGCCTTGTG
GACAATATATCACATAATCTCATAACAGAAACTAAAGCAAATTATAAAAATGAAGGGTGG
GTGTGTGGTAGCAGAATTTTCACACATACTACTTGCTATCCAAAGCCCTGAAAATGGCTT
TATTAACTATCAGGAAGTTTCAAATTCTTTGACATAATGACCAGGCTACATCAATGTCCT
TAGAAACATGGCCAAACTATCATTAAGAAGAGATTTAACCATTTATATTCAGATTGGCCA
AATAAATCAGAGTTGAAGAATAGGCTACGTACTCCTTCCTCTGAGCTCAATTCCCTTTTA
GCTATTCTCTTTTTAATTTGTACCTTGAAAATGTAGCTCTAAGCTCTATCATTCCCCAAT
GTTTTATCCAAGTGATGGACAAGCTCTGGCTGTGGCCTGCTTTGTGTTCTTTTGGGACTG
TTTCTCTCTTAAAAGGGCCATTTTCCATTGTGGAAACTAGTGTCAAAGGCTTGAGGTGAA
TGAAGAGGAGGAGGAGAATGTTAAAGAGACCCTTTCAAAACCAAAATTATATGTTCAAAT
GAATATGTTTTCTGTACCTCTGCAATATTAACCGTGCAGAAGCTAAACTGCCTGTCAGCA
TCTATACTGTGTGTTTACTTTTACACTTCATTTAGGTAAGAGCCAGGCTCCCAGACAGAG
CAATTTGCTTATTGGTTGCATGTTTTTAGTCTCTGAGCGCCAGCACAAGGATATACTGTT
CAGATGCAATGACACTGACTAAAGAAACTTAAATAACAAACACCTTTTATTCACCTCAGG
GTCTCTCACCAGTGTCTATAGACTTTCCTTTCAATCAAAATTGTACACAGAATCCATCTC
TTACTAAACTCACATTATCTTTAAAGGCTTCTCCATAAAGTTAATTCAAATCCCTTTCAA
CCTTTTAAGAAAGGGTTTATTTAAAAAAAAAAGAAAAGAAAATATTTTGTTCTTTCTTTA
TTTCTGTGTTGCCCCTTGTGGAGGCAAAACACAGGGATAATACTTTTACTCCACTTTCTC
TACATATCTTTCCAGGCATCTGACATGCAGCAACAAGGAGAATTAATAACAGTAAATCAC
ATGTGTAGTTGTATCACATGAGCACACACCCCTCTCATCCTGGAAAACTTCACTTCTGGG
GATGGGTAGCCTCAAAATAATGCAAGTCAGGGTTATGAAATAGTGTGATGCCATCTCAAA
CAGAACCTCTTACAACGTCTCTGGAAATGACTACACCCAAAGACAGTGGCACAAATGACA
AGAGCATTCAGAGAAGTGATTCAACCTGGTTGAGAGATTCTGAGTGACCCTCAAATGCCA
CCACAGAAACCACCACCCTTGCCATACTTGAAGACAGAAAAGAGACCATCATTCAGTTGC
AGCTGTGTTCATAATGTTTCCATTTATCACACACCCAGTCCAGTCTTGTTTCTGGATATG
TGGGTCCTGGGGTTGCTTCTGCACATGGTAGCTATTACATAAATCATCAAAAGCAAACAT
AATAACATCAGTCGTGAACTTGGTCACTAATCAAATCAGTAGGCAGGGACAAAGAAATAC
AGAATAGGAATATACAAACCATATGCAAAAAGAAAAAACAAATCACTCATCCTTCCCAAT
TTCCTAGAATAGGAATAACAACATATTGCAACATAATGGAACACTATACATTGGTGAAAA
AAACAATAAACTTTATTGAAGACGTATTTGTTTGCTTTTCCATTTTATGTTCAATAAGCT
GCTTAATGGGAGAAACAACCTCACTTAATATTTGTGGGTAACATTACAGCCCCCATTGTT
TATATGAGAGATGACTGTTTTTCATGTTTTTCTTAATGAAACATGACATTTATATAAGAA
ATATATGTATATAAGTAAAATTCTTCCAATAAGTTTTTTTTTTTTTACTTTATAGGCAAA
AGGCAATTGTCCTTCCAAAAAGTAAGAGTTTAATATACTGAGATCAAATCACTGATATTT
CCATGGTATCTGCTAACACGTATAAAATATGATGTTGAAGAGGGAACTTCCTAATTAATA
ATATGTCTGATATACTTGTGTACTCCTCCACCTGCCTCCAAATTGCCTTCCACTAAAACA
AACCATTAAAAACTTCCCATTCAATGTATACTTTTGTGGAAATGAAATAATCAATTCAAT
ATCTACTTTTCTAGATCTCCCGTCCTCACTGACATGCACAATATAAATGAGTTTTTACTG
TTAGAACTTTGAGCACCAATTCATATTCTCATAAAAGAATTTCCATCTACTAATAAGAGC
TCTTACTATTCACATTTTTAACAACAATAAACACAAACCCTCTTTGGGTTACTATCAATA
ATAAAGACGTGCATTGTGGTAAAATTTCCCTAGTTCACAACAGATATTTTCTTCTTGAAC
ATCTGATTTTCAGAAGAACAATCCTGTCCTGAATTCTTTGTAATTTTACAAGTTACTTCT
TCTCTTTTCTTGGCGCATGGTTTTAGTTTTCTAGTGTTTATTTATGGAGGATGCATTCCC
TTGCGTCTCTATTATTTCGAGTTCCCCGTCTCTGGTTCTAAGGTGCTGCCTGCCTAAAAC
ACACCACTTCACTGAACACCTGGCTTCTATATTCCTCTAAAATACAGATGTACAGTTGCT
TTTTCTGGCATCTTGGGCAAGGTCCCACAACACTTTTAGGGAAACCAAGATTGTCTATTT
TGATAACTACTTTTGCCAAAATAGTTCATTCTTCTCAAGCCTGGTTGAGGGGGTGGAGGG
GACCTTTAGAAGTCATATGGGCATAGCAGGTGGGGGAAAACTGACAAAAGACCAGGGCGA
AAATCATCCTCTGTGTCCCTGAAGATCTTAGTTGAAAATGCTCTACTAACATCTCTCACC
AGCAAAAAGCCTGGAACACAGTATTTTTCACTTAGAAACTAAGATCACTACCTCTGATTT
TGAGAGAGCAGCCCCTGGGCACTACCTGAGCAGGTAAGGGAGACCACTGCTCTAATGCTC
ATAACAGCTCTGAGATTTAATGAATCACAGACCCATCATCTCTTTCTAGGGCAACGTATT
TTATTTTTGAGAAACAAAGTAAAGGAGGCTTCCCTTACAAATGCTGGATTTCTGACAGCT
AGTTTTCAGACTTTTCTTTCGCAAGTTGATATCTAGTAACTCAGGATCACTGCCTGAAAA
TCGCTTCCAAAGGGTTCAAATTTGAATCAATGTAGAGGAGGTGGCACACAGCTGCTTGCT
TTCATTAACTCTTACCTCTACCAGAAACCAAGCAGCTATGATGCCCAATCACAATTTCTA
TGACCACTTTCTTATCTTGTCAACTCTCTGAGAGTTCTGAGTAGCATTTCTCATTTCTTG
CTTTTCAGTACCCACCCCTCGAACATACTTCCTCAGTGTACCTCAGCCTCCCATCAAGCA
AAAAATCAAAATTCCAGTTTATGGCAAGAGCAGAATAAATGCAGCAGTCTCCTCTTCTCC
ATCATTTTCTGACTTTTCCCAAGTTATCGTACCAGCACAATGCCTTCTACTCCCAAATCA
CAGCAAGATATTAATAACCCTTAGTAGAAAGATTCCTTATTAGGTCACACAGAGTCATTA
TGGCTTAATAGCTGTCACCCTCCCAAGCTAACCTGTGCAACAGGTGTGGAAAGTAAACTT
AGAGGCTCACTTGGCAACCCCACAAATAGGGCTTCACAGCTCTCCCCCCAATGCTCCCAA
TGGCCTCtGGTCCCCAGCATATGAGCCCCTgCCCCTGTAGACCTAGGGAGAAGCCCTTCT
CAGCTCAGCTCACCTGTTTGTAGGCATCGAGGAGGAAGCTCTTCCAGACGCAGCGCAGTC
CCTCTGAGGTCAGCATGCGCCGCCACTCTCCGCGAGTGGACTTGGAGCGGCTCAACAGCA
GCACCAcGTGCTTGAGCAGAATGACCGAGTCATAGAGAGCCAGGAAGAGGCAGTTGGAGA
AAAAAACTGGCAGAATTTGCAGTGTGATCAGCAAGTCTACGCTGAGGATGCCCATCTTCT
CTGCCTCCTGAGTCAGTTCCCTT
Chart Advanced