SelenoDB
Release 2.0
Chart Advanced
Transcript Report for SPT00002457_2.0
Identity
TranscriptIodothyronine deiodinase 1 (DIO1)
SpeciesSus scrofa (Pig)
Transcript IDSPT00002457
Transcript release2.0
External IDNone
Gene SPG00002364_2.0
Annotation
Prediction method(s)
(Selenoprofiles, Ensembl 68) [Report annotation error]
OrientationForward (Reverse in the original sequence)
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Full length Spliced 5UTR CDS 3UTR
Forward Reverse  
Sequence
>SPT00002457_2.0 # Transcript # Iodothyronine deiodinase 1 (DIO1) # Pig 
ATGGAGCTGCCCCTGCCAGGGCTGTGGCTGAAGAGGCTCTGGGTGCTCTTTCAGGTGGCC
CTGCACGTGGCCATGGGCAAAGTGCTCATGACATTGTTTCCTGGGAGAGTCAAGCAGGAC
ATCCTGGCCATGAGCCAGAAGACGGGCATGGCCAAGAACCCTCACTTCTCCCACGAGAAC
TGGATCCCCACCTTCTTCAGTGCCCAGTATTTCTGGTTTGTGCTGAAGGTCCGATGGCAA
CGACTGGAGGACAAAACTGAGGAAGGGGGTCTGGCCCCAAACTGCCCCGTGGTCAGCCTG
TCAGGACAGAGGTGCCACATCTGGGACTTCATGCAAGGTCAGGAGGGTGGTCCAAGCTCG
AGAGGTGCTTGGACTTGGGCGCTCAAGGGAGGCGGGCAGGTGGGTTGGAAAGTCCAGGAT
GCTGCTGCTCCCACGGATCCTTGTTGGCTTCTGGTCCCCTTCCCGCTTCTTGAAACTATG
ACCTCTTCTGGCTTCTCTTCTTCTGAGTGGCCTCACCACCTGCCCTGACACTCAAATCAC
AGACCAGCCACCCTGGCCGTCAGCTCCTCCAGCACCGCTCTTACTGCGCCGTCGCTCTGC
CTGGCAGGCTCTTCACCCTCTCTGCCTAGTCCCTCCTGTCCATCCTTCAGACTTTTGCTC
AATGACATTTCCTGGGACAAGCCAACTCCGACTCCTCCGGCCTCTGTTACTCCCCCCTCT
GTGGTTAACATCCTAAACCGTTCTTTATCACACCCGTCGTGGTTTGCAGTTATGTGTATT
TGATTAACGTCTGTCTCCTTCACTAGCCGGCAAGCGCTGTGCGGGTGGAGACCATCCCTG
GAACCCACGGCCGCCTCCTCCTGGCTGCGGCTGCCTCCTGGCAGTGGTTCAGTAAATATT
TGTTGAAGATCTCGCTCTCTTTTTTCCAGGCAAATCAGCTCTACTTGGATTCTTAAAGAC
CCCTCTGCTCAGTTTTCTCTTTTGTCCTCATGGGAAGCTCCTCCGCCTGCCAGGCCTTCT
TCCTCCCGTCTTGCCCTCTCTTCCCACCCAACTTGTGAATGGCTTGTGAACCCTTCCACA
AGCACTCCCCTGGCCCACTGGCACCCCAGCCCAGAACCTCCAGCAGCGCCCCCCTCCTCT
GCATGTGGGATGAAGTCCTGGCTCAGCCTTGTGCGGAGGTCTCCCTGACGGATGGCAGTT
TGGCTTCTCAACTTCACCGACAGGCTTCCCCTCAGGCTTCACTGCCTCCAGGTCAACTGC
TGGTCCTTGCGCTTTCCCTTGTCGTTGCTTTTGCTGGTGGTGTTGGTGCTTCTTCTCTGT
GGCCAACATCTGAGTTCCCCACATTGTCAGGGTCCTTCTCTCATGCCTCCCTCTGCGAAG
CCCGCTCAGATCCCTACAGCAAGGCCCACTCTCTTTCCCTTCTGAACCCGTGGCTCTCCG
TGTGCCGCTCTCCTGGACACTGTTCCTTCCTCCCCAGCATCTGGCTGCCCAAGCACAAAT
GTTAACCTCCTGCTCAGTGGGGAGCCTTGGGACAGGGTTGTGTCTGATTCACCTCTGAAT
TCTCAGAGTCTAGAGGCAGCTAATAGAGTAGACAAGGTCCCTGAGGCAGCAGGCTCATCT
AGTGGCTTTTCAAAGCATGTTCTTGGGAACCCAAATCCCACAGATAAGCTTTATGACAGA
GTTCTCTGGTCAAAATAGTTTGGGAGATGCTGCACACTCTGCTCTCCTCCTGGGAACTCA
TCGTGCACATGGACACGGAAAGGCTCTGAGAGGATTTCCCTGGTGGTTCAGTGGGTTAAG
GACCCAGCATTGCCGCTGCTATGCTTGGTTCGCTGCTATGGCATTCATTCAATCCCTGGT
CTAGGAACTTCCACATGACATGGGCATGACTAAATAAATAAATAAATAAATAAATAAATA
AATAAATAAATAGTTTTTAAAAAGAGAAAGAAAAGGCACTGAGAGGCCTAAAGCTTAGAA
AACAAAGTTTGAAAAAACTTGAACACAGCACCGACTAATTTTCTTAATACACACATACAA
CTTCCCACTCTCCACCAGGGGAACATCCTGTCATCATCACATTGGTTCCAAAGAACACCC
TCTGATCCAATCCTCTTGTTTGAAAAGGGAAATGGAAGAAACTAGGAGCAAAGGTGACAG
AGCCAGTAAGTGACTAAGTCAGAGCCAGAATCAGGGCTTCTTTTTTTTTTTTTTGTCTTT
TTGCCTTTTTGCCTTTTCTAGGGCTACACCCACGGCATATGGAGGTTCCCAGGCAAGGGG
TCTAATCGGAGCTGTAGCCACCTGCCTACATCAGAGCCACAGCAACGCAGGATCCTTAAC
ACACTGAGCAAGGCCAGGGATCGAACCTGCAACCTCATGGTTCTTAGATTCGTTAACACA
CTGCGCCATGAAGGGAACTCCCAGATTTGTTTTTTCAATGAACCCCAACAGCCATCCATG
AACACCTCCTCTGAGCCAGACCCTCAGCCAGATGACAAGGACTCGGAGTTAGGTAAGAGG
AATTTATAGTTCCACAGAATAGACAGATATGGTGGTTCCCAGGCTAGGGGTCGAATTGGA
GCTACAGCTGCCAGTCTATGCCACAGCGACGCAGGATCCAAGCTGCATCTGCAACCTACA
CCACAGCTCACAGCAAGATCCTTAGCCCACTGAGTGAGGCCAGGGTAACTAGTGAGATTC
GTTCCTACTGCACCACAAAGGGAACTCCCGAGAGAACAGTCTTAAAACTCCCGAGAGAAC
AGTCTTTAAATTGGCCACTGGAAAGTGAACAGTTAAATAAGCAAGGAAATCCTGCAAATG
GGCCATCCATGAGGCAAGTTGGCTTTCACAGCTCTAATCACTAGATGACCAAAATTCAGC
AAATTAGCCTGGTCCCATCACAGTACTTGGTGCGAGGTAGACACACAATAGAGATTAGCT
GTTATTCTCATTGCTCTTATCAGTGATCACTTACTGCCATGTTTGTTGAATAAATAGAGG
TTATTTGTGCACTATGGTTTTATTATTATTATTATTATTATTATTATTTTGTCTTTTTAG
GGCTGTACCTGCAGCACATAGAGGTTCCCAGGCTAGGGTTCGAATTGGAGCTGTAGCCAC
TGGCCTACACCACAGCCACAGCAACACCAGATCCGAGCCCCGTCTGCAACCTACACCACA
GCTCACAGCAACGCCAGATCCTTAACCCACTGAGCAAGGCCAGGGATCGAACTTGTGTCT
TCATGGATGCTAGTCAGATTTGTTTCTGCTGAGCCATGACAGGAACTCCTGCACTATGGT
TTAAAACCATGAACAAAAAACCTCTTGCCCTTCTCTCTGATAGAAAGATTCTTCCCTTTC
GAACATCGAAAGTCTTATTTGTTCTTCAAGGCCTAACTCCAGGAAACCTTCCAAGCCCTG
CAGGCAAAATTCATAGTTTTAGAGTCTCCCTGTCTCAGCAATGACACAGATTTGGTTATT
ACATCTGTCTGTTCTGTGGAACTATAAATTCCTCTTACCTAACTCTGAGTCCCTGTCATC
TGGCTGAGAGCCTGGCTCAGAGGAGGTGTTCATGGATGGCTGTTGGGGTTCATTGAAAAA
ACAAATCTGGGAGTTCCCTTCATGGCGCAGTGTGTTAACGAATCTAAGAACCATGAGGTT
GCAGGTTCGATCCCTGGCCTTGCTCAGTGTGTTAAGGATCCTGCGTTGCTGTGGCTCTGA
TGTAGGCAGGTGGCTACAGCTCCGATTAGACCCCTTGCCTGGGAACCTCCATATGCTGTG
CGTGCAGCCCTAGAAAAGGCAAAAAGGCAAAAAGATAAAAAAAGAAAGAAGCCCTGATTC
TGGAAGGCCTGGAAGCCCCTTTAGATAATCTAAAGCAACCCTTTCATTTTTCAGATGCAA
AGGCCCAGGAGGTAAAGGGCTTGCTCAGAGTCACACAGAGAGTTCTTACAGAATCAGAGC
CAGAACCTGAGGCCTCTGACTCTCAGCTAGTGCTTTCTGTTATTGAACAAAACAACAGAA
GCTCAGAGAAACTCTCAGCCACCTGTTATCCTCTGCAGGTACACACACATGCACACATGA
GACATGTGTACACTCTCAGACACACATGCACCCAGAACATGAACCGGCATGTTGTGTAGA
AGGCAAGTCCAGATGGTTTGTTTTCTTGGCACCTGTTCCTCTGAAAGGGGATTTATTTCA
GCCCTTATTTAAATATTCTAAGATCTTGCCAAGTACACTTATGAGGGATCATCTAGTAAC
AACAAACGGGCTTTCTCTGCTGAGAGAGCCTGGCGTGGGGGTTCATTTACTGGGTTGGGG
GTCAGCCAATAAGTTACCCAAGGTGGGGTTCAAGTCTAGTGCTACTTGAGAGTTGTTTTC
CCACTTATACAATCAAGCTGGACGTGACAGTCTTTGTCCGCAGTGGTGCCCCCTGCACTG
TGGCCTGCAGACCTGGGCAGGGTGCCAGCCCCTAGCACAGCTACCCCCTCGCACCCATTC
TTCCTCTCTCTGCTACCAGGAAAGCAGGGAACTGAGCTTAAACTTTGCCCTCCATACTGA
TCACTGCCCCCAGCCACCCTATAAATAATTAAACAAGTGGCTCTGTTTCTACAGGGTCCT
AATCAGTAGATGTTGAAATTTTTTATCTAATTAAAACCAAAATTCCAGACAGCTCATATT
TATCACTGGTCCTGACCTTAAATAGCCTCAGTTCTTATCTGAAGGGTGACTCCCTGAGGT
CACTGGAGGCCAGGGGCCTGCCACTTGGCCATGTCTGGCCTCTGTGCTTCTGCTGCCAAG
GCCTGGGCAATCCTGTTACGTGGGTCAGATGCAACCAAATGCTTCCTCGGGCCTCTTATG
GGGAAATCTGTGAGACAAGGACAAGGAGAACTCTGTATCTCCAGAGAAACCGGCCCGCTT
TCTCCTCATGGACTGAAAAACGAGAAATACATAAGCAGTCATGCTTCTCCCTTTACCTGG
CCACCTGGAAACTCAGAGTCAAATATTAGCTCCATTACAGTGAATGCATGGAACCTGTTG
TATGCCTCCCAGAGCGCCATGGTTTTTAAAAAAATTTTTTACGGGAGTTCCTATTGTGGT
GTGGTAGAAACAAATCCGACTAGTATTCATGAGGACGTGGGTTCGATCCCTGGCTTGCTC
AGTGGATCGGGGATCCATTGTTGCTGTGAGCTGTGGTGTAGGTCAAAGACTCAGCTCGGG
TCTTGTGTTGCTGTGGCTGGAGCATAGCCTGGCAGCTGCAGTTCCAATTTGACCCTTGCC
TGGGAACTTCCATATGCCGCCGGTGCGGCCCTAAAATGCAAAACAAATACATGTGTAAGC
TGCTTCAGATCCTTTGCAGAACAAGGTGAAGGAATAATTAACCAAACAAATCACAAGCCA
AGTTTAGATGCCCTCTACTCCTCATCCATCAACTAGTCCTGCCGGTTCTAGCTTTTCCCT
TCTCCACCGCACACACATTAGCCCAGACTCCCGTTATCTCTCATGTGGATTTCTCCAGCT
CCCCCATAACTGCTTCTGCCCCACTTCTATGCTCATCCTCAGGAATTTCGCCACCGAGCA
GCCAGAGTGATCTTCAAGTGTATACTGATCATTTTCCATCACATGGCCTACTGTAGCCGT
CAGAGTTCAGGCTCGCAAGCAACAGAAACTCACGCTGGTTGTCTTGGTCACACACATATA
CACATACAAATACAAAGTGTATTAGAAAGACATTGCAGCCTCCACAGAATCACCCACAAC
TGGAGCGCTAGGCCTGGACCATCTTTTAGCATCAACAGTTGGGCCTGGAAGCTGTTGGCA
CTGCAGTTGCCATGGGAATCCATCACCCTTGTAGGATTCCACCATCTCTGATGGGAAACG
ACCACTGGGCTATGGATGAATTCTACAATCCCACTAACTACAGAATCGAAATAACTCTAT
GGGAGGGCCCAATCAGCCCAGCCTGGGTCGCTGCCTGTGCCCTGGCTGCTGGGAGCAGAA
ATTGCTTTTATAGAACAAGGCTGGGCACACTCCCCCATCAATAGTATATAAACTAGGGAC
TTCCAGATAGGAAGGAGGGCTAGAGGCTGGGCAGCCAAAATTACAACAAATACCCACCAT
CCTTGCTTTATATCTCCATGATATCCCCTTGCATCTGGGGGGAAAAAATCCAGATTCTTT
ACCAAGGTGTAGAAGAACCTGTCTGCCTTGGCCCATACCTACCGCTCCCATCACATCTCT
CATTGCCCCCTGGCCTGGCTCCGGTCACAGTAGCCTCGCAGGTCCTTGAGTGCACCAAGC
GCTGTCCCGCCTTTGTACATGGAGCCCCTGTGCCTGGAGTGTCCTCCTCATCCCTCTGCC
CACGGCTGGCTCTTTTCTGTTTCTCAGGGTACATGACTTCTCCTCAGAGGCCTCCCTGAC
CCCCCTGTCTAAAGTAGGTCACTTCTTCATAGTCTCTTTTGTGACACACATCACAATTTG
AAATTACTTCATTGATGCCCTCTCTCCCATTAAACAGACCTCGCATTGCATGCAGGCGGT
CTTGCTCTCTGCTGAGTCCCCAGTGTGTGGCCGAGAACTTTGTCTGTTATGAGTGCTGAA
TAAATGCTTATAACGGAATGAGAGTGAGTTCGGAGGAAGGGATCTGAGGAAGCTGGAGGA
ACAAGCCCTGCTCTCAGGGACAATGCGTAGCCTCGAGGGTACAGTCACTTAAACAGGCCA
TGTCACAGTAAGGGACCCACCACGTTCTAACAGGTGTACGGTAAGGTTCAGCAATGTCGG
GTCTGCTCATGAGTAACCACAGGGTGCCGGCAGCTCCCTAGAGTTACCCCCCATTTAGGC
TCGGGGAGTTATGGGAGGTCCCCAGCCAGGGCTGGCTTCACAGGCATGGGACCAGTGAAG
CCCACAGGGTGGTGCCACCTTCCGAAGGGGCTTGGGGTTGAACGCTTTGCAGTAGCTATC
TTGAAACTCTTAATAGTTTTATTTAATGTGCATTTTGTAAGAGACACCTATGAGGACAAT
GGAACATGCCTCGGGGACTCGCAGCCTTGGCTCCCACAGGATTCTGCCTCCCACAGCCTC
TCTGTTCCCCCCAGATTTGTTCTCCAAGGCCCACTCTTCCCCTCCTAATGCCCCGGTCTA
TCCAACCTCCTTCCTACTCCCACCCCATGACTGCTGCCACCTTCTGGCCCCAGAGATGGC
CTGGATCCAGAGATGGGAACGGTCAGGGTCAGGTGTGGGCATCCTACAGTGTCTCATAGC
GGGGCATGGGAGGCAACCACCCCCAGCCTGGGCTGACAGCATCGTGGAGCAACTTGGCAA
GTGATTGGGGATGACCTGGTAGGAGAAGCCTTTTGTTCCTATGCCCCCATCAAGGCACCT
AGTCTATCCCTGCCCAGAGGTTGCAATATCCTGTGGGTTAGGGTGATGGGCAGGTGGGAA
GGTGATATGTCTGGCTCAGTTTCTATGTTCCTGGCCAGGGCATGAGGCATTGGTCTGGTG
GCTACAGGGAAGGAAAGCTGGCATCCAGTGGCCACAAGCACACATACACATGGGCACAGA
GTTTAGGGGCTCCTGAGTGACTTGTGAGGATCTGTATCCACCCTATGAATAGCCTTCTGC
CCAGGGTGGCTTATGACATTAAATAGAACCCCACCAGGTCAAGGGAGATACCACAGAAGG
AAACTTGGTATTTTTCTATTTAATAGCACTTTCCTCCAGTTTTTGAAGAAGAGGCCCCGC
ATTTTCATTTTGCACTGGCCCAGCCAATGTCACCACTCTTGCTCCCATGCTTCATTTTCC
TTTGTGGAGTCCCCTCCACTCTCTCCTTCCCCAGCTCGGGGAGGAAATGAGAGCTAAGAA
TAGACAAGATTACATCTATTGAGCACCTACTATGGGCAGGCACCATTTCAAGCCCTTACC
TGTTTTTTGTTTTGTTTTGTTTTTTGTGTTTCTTTGTTTCGTTTTGTCTTTTTGCCTTTT
CTAGGGCTGCTCCCTTGGCATATGGAGGTTCCCATGCTCGGGGTCTAATCGGAGATGTAG
CCACCGGCCTATACCACAGCTCACGGCAATGCCGGATCCTTTACCCACTTAGTGAGTCCA
GGGATCAAACCCAAAACCTCATGGTTCCTAGTTGGAGTTGTTAACCATGGAGCCAGGACA
GGAACTCCAAGCCCTTATCTGTTTTAACTTATTTGATCCCCAGAACAGTCCTATAAGGTA
AGTATTGTTACTCTGTCCATTTGTGGATGAGGAGATTAAAGTGCTTTGAATGGAAAGAGC
ACCAGATTGAGAGTCTAGAAACCAGAGTGGTAATTTTAACTCCATCACTGACCTGCTGTG
TGACATGAAGCAAGTTTAAAAAGCAGGGGGAAAAAATCACCCACCTTGTGGGACACTGAG
CACATCAGTGATAGAATAGATGTGTGTGCCTAGCTTATAAACTGCATGAAAGAGACTCTC
CTTGTACTTATTTGAATTACCACCCAGCGAGTGCAGGTGGTCCACTGAGACTGCCTGATA
GAATCCCCTCATTTTCGAGAGGAGTAAACTGGCTCCAGCCTCTACTAAATCATGCTCTCT
AGGCTTCTGCCCCACCACCACCCCGCGGTGTGACCTGCCTCCATTTTAGAGGGGAAATAA
AGGAAATAAAATGAAAGCAGGAGTGAAGATGGTGCTTGAAAAAGAGGAGTTCCCATCGTG
GCTCAGCGGAAACGAATCTGACTAGTATCCATGAGGATGCGGGTTCAATCCCCGACCTCC
CTCAGTGGGTTAAGGATCCGGCATTGCCCTGAGCTGTGGTGTCAGTTGCAGATTCAGCTC
GGTTCTGGCGTTGCTGTGGCTGTGACATGGGCCAGCAGCTATAGCTCCCATTTGACCCTT
AGCCTAGGAACCTCCATGTGCCAGGGGTGCGGCCCTAAAAAAGACAAAAGAAAAAGAAAG
AAAGAAAAAATGCCACGTATTGATTATTGGTTGATGATGGTCCCATTTGTTTTAGGCAAC
AGGCCACTAGTGCTAAATTTCGGAAGTTGCACCTGACCTTCATTTATTTTCAAATTTGAC
CAATTCAAGAGACTTATTGAAGATTTTAGTTCCATAGCAGATTTTCTCATCATTTACATT
GAAGAAGCACATGCATCAGGTAAGAAAAAAGATCCCCTGCCTCTATCACTTCCCTCCCTC
TCTCTCCTCTTTGCTCAAGTTTGGGGGTGGGGGGAAGGACAGGAGGAGAGAGGAAGACAG
CGCTATTCACTGAGAACCCACCATCTCCCAGGTCCTGCTAGGCTTACCCACCACCCGCTA
ACTCACAGTCTGTGTTCTCAACAAGGCACACAGAGCAGAAAACCTGGGGTGACAGGTCTA
GCATGGAGAGTATCCAACATTCTGAATGGATCTATAGGGAAATCCAGGGCGAGGAGCTAA
TATGAGTACAATTACAAAGACTTTAGACCTGAAAGGTCACAAGTGAAAATGGCAGCTCTA
TATCTATTTGTAAAATCCATCCTAAGACTGTCCCAGGCTCAAAGGAACATTGTGCTGCAT
CTCCCTCAGCGGTTCCCAGGCTTTGGTGGGCACCAGAAGCACCCAGAGGGCTTGTTAAAA
TGGCCTGCTGGACCCCACCTCAGAGTTTGAGTTAGATCTTGGGGTGGGGCCTGGGAATTT
GCATTTCTAACCAGCTCCCGGTGGTCCTGAAGCTGTAGACTGGGGGCCACACTGAGAACC
ACTGCTCTGGGCCAGCTTTCACCTGGGGCTGGGATCCCTTTGGCTCCTAAGAGGCGATAA
CTCATCTCCATCACTTCATGGGAATCCCGTTCCTCTGCTGCACAGCTCTAATTGTGAGAA
AATCCTTACGCTGGGCAGTCATGTCCTTCCCTGAAACACCTATGGCTTGGTCTAAGCACC
TTGGACTTTGCAAGATGGTCAGACACATCTCTGTCTCCCTGATTTTCATGGGGACTGAAC
CCATGAGTTTGGCCCAAGTCTTAAACCCAGAGATTGAAGGCAAGGAGGCTTATGTGGCTG
AGCGGAACGAGCATTGTTTACTCACCCACCTTCCCGTAAGATGATCGAGGCTGTTTTGAT
CACCTGTCACTCAGCGCCTGCCAGAGTCCATGTCCCAGAGTCAGAGCTCAGTAAAAGCTG
GGAGAATAAGTGAGTGTTTCGGTCAGTATTAGCCTTGCTGGCTTATCCAAGTGTAGTAAG
TGTAGAGATGTTTATTACTTAGTATCAGCAAAAGCTGGTTCAGCAGTGCTTCCCNAGGTG
TGGTCCCTAGAGACATCTGGGTGNCTTGTGAAAAATGCATATTCCAGAGTTCCCACTGTG
GTTCAGCAGGTTAAGAACCTGTCTGGTATCCATGATGATGTGGGTTTGATCCCTGGCCTT
GCTCACTGGGTTAAGGATCTAGCATTGCTGCAAGCTGCAGCGTAGGTCGTGGATGTGACT
TGGATCTGTCATTGCTGTGGCTGTGGTGTAGGCCTGCAGCTGCAGCTTTGATGTGGCCCC
TAATCTGGGAATCTCCATATGCTGCAGTGAGGCCCTAAAAAGGCAAAAAAAAAAAAAAAG
CATAGGGTAATAGGTACATGGAGGTTCATTACACTGTTCTCTCTGCTTTTATGTTTATTT
GAACATTTCCAAAATAAAATTGAAAGTAAAGAGCATAGGTAACAGGAGAGCAAAGGCAAC
CACAGTGTGTCTCTTTGTCAAATACCCCTTTGGGAGAGCAGCAGCCATCAAGTAAAGAAA
GGGAGCTGGCACCCCTACAGGTGGCTGTGGTCTCCACGGCTGAGAAGACCACAGAGGTGA
TGCCCTGATGTCCTCAGGGCTGAAGCTCTGCCAAAGCTGATGTAACTGTGGGGGCAGCGC
TGCTCAGTCTCTAAAGTGAAAACACCCTAATCCCTACACCACTGGAGGACCCCCCCCCAC
CCCCGGTGACCTTATTAAGATGCTCAGGCTCAGCAGGGCTGAGGAGGAGCCTGAGACTTA
GCATTTTTAACCAGCTCCTCAGATGATGTTGAGGCTGCTGGTCCAGGAACCACATTTGGA
GTAACCAGGTCATAGAGGATTCAGCTTTAATCTCTCAAAGAACAAACTGCAAACTTCAAG
AAGGGTTGGCCGTCACAGAAATTATTTCTGGTCCTGATAACTGCCTCCTCCCCCATTTCT
CCCGGAATCAGATGGAGCAGATTTAACCCTTTCCTGGACCCAGTGCTGTTCCCCTCAAGC
CACTGAGGAAAGGCTTCCTGTCCCAGTCCTGACGCACACCGGTTTCTGTGCTGGGTACCC
TCTCTGCTGTCCATTGCTAGTTTGAGCGTTTCTTCCTCCTCCCCATCCCCTTCCCCAGGG
TACCTGCTTCATCAGACAGAAGTAGGTAAGGCCTGAGCCTCAGAATTAAAGAGCACACCG
AAGTTCTGTGGTGCAGCAAGTTAAAGATCCAGCATTGTCACTGCAGCAGCTTAGGTCACT
ACTGTGGCTCAGGTTAGATCCCTGGCCTGGAAACTTCCACATGTCATGGGTGTGGCCAAA
AAAAAAAAAAAAAAGAGGAATTAAAACGTACAAAGCCATTGTCCACCAATTCTAGGAGGT
CTGGGGTCTGGGACCCACATCAGTTGGCTTCCTTTTTTTGCACACAGCTAGTGTTACAAC
ATGTTTGTTTGTCTAGTAAATCATGGAGAAGTATGCAGAGTGGTGGAAAGCACACAGAGT
TTGTAGTTTCATACCTGAGTGGGAGTCCTAGCTCCATCACGTCTGGCCATGCGACCTGGG
CAACCTACCTGCCATGCCCACTTCCGTGCCACTAAAATGGGATCATCACACCTATCTCAC
AGAACAACTCTTTCAACAGGGTTTAACAAGCACCTACTATGTGCCCAGCCCTATGCCGGG
CCTAGGGATATATAGAGATGAAAGGTACACGCAGTTCTTGTCTCCAGGGAACTCACAAAG
ATGGGAAGGCTAGTCACCATGCCTCTCGGGCCTCCTCGTTCTCAGGGGCAGGGTAGGGAC
GAGAAGCCCCGCTTGGCCTCCCACAGAGGCTGCTGTGAACTTCCAGTGAGCTAATGGATG
GACAACACTGACCTTCTAGACATAATACACATAAAGTCTGATGTTACTGTCATCAGCAAA
GATTTGCTCTCTTGAGACAGATAATAAATACTTGAAACTGTAGCCAGGCCCTTTTATCTT
GGTGTGAATTTCTCCTGAGAGCTGGATTTTCTTAGGGGAAGGTTTCAGAGCAAAGAGAAC
TTTGAAACATGGAGGAGATAGAGCCAGTTGTGCTAAGAGACTTCAGTAACTTACATTACC
CTGGGAAGCAACTATTATTGTAAACGCAGGCTGCGTGGCTTCTGAAAGAACCTATGACCA
CATTATCTGGGTTCCAATCTTCCCAGATGCAGGACAAGTCGAAGGGCAAGGCCAGCAGCA
GTTTACAGTTCCTTTTTCAACCTGTGGGTCCATTAGCTAGTGAGTACCGTCTCCGGTAGG
TAAGAACTCATCTACGACTAAGGATGTTACTCATTCGTCATGCATTGCGTGTGAAATACC
AGCTATGTCTGGTATCAGTTTACTACGGTACTTTGTATTTTGATTGTGTATCAAAACATA
ATTGTGTTGTGTTTAAATACAAAAGTGAGGCTAATTGAAAATCCCCTTCCAAAAAAAAAA
GAAAAAGAAAAATCCCCTTCCAGGGGAGGTCCCTGATGGTTTAGTGGTTAGGACTCAGCA
CTTTTACTGTTGTGGCCTAGGTTCAATCCCTGGTCGGGGAATTGAGATCCCCACATCAGG
CTGCTGCATGCCACAGCCAAAAACAAAAAAGGAAAGAAAGAAAATCCCCTTCCATTTAAA
GTTAAGCAGCCTTGGATTTCCCATTGTGGCTCAGCAGGTTAAGAACCTGACATAGGGTCC
ATGAGGATGTGGGTTCAATCCCTAGCCCTGCTCAGTGGGTTAAGGATCTGGCATTGCTGT
AAGCTTCAGCATAGGTTGCAGATGAGGCTCAGATTCCACATGCCTATGGCTGTGGCTGTG
GCTGTGGTGCAGGCCGGCAGCTACAGCTCTGATTCGACCCCTAGCCTTGGAAATTCCATA
TACCACAGATGTGGCCTAAAAAAAAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAG
GAAGAAAGAAAGAAAGAAAGAAAGTTAAGCAGTCTTAAATGGGTTTGGTTTGGGGGTATC
ATCTCCAGAGCAAAGTGTAGAACATCTGCAGTATAGAATGAAAACTGGCTTTTTTCCCCC
ACCTGTTTGTTATTGGGGGCAGTCAGACAAAAACCTGCCAATATTTTTTAAGCAGCTACC
ATGAACCAAGCACGGTACTGGGAATTCCGTATGAGTTATCTCATGCAAGCATCATAGCCA
TCTGCAATGTAGGTTCTGTTAAACCCATTTAACAGATGAGAAAACAGAGAATTTAAAGAG
ACTTAAAGAGCTTGCCCATTATCACACAGCTGAGCATGTCAGGGAAGGCTTCCTGAAGGA
GAGGGTGTTACAGCAGTGATTCTCAACTGAGGGTGATTTTTGTCCTGCAGGGGACATTTG
GCAAGGCCTGAAACATTTCTAAACCTAAAGGCAGGGGGACGCTACTGACCTCTGGTCTGG
AGAGGCCAGAGAGGCTGCTCAACACCTTACAACACATAGGACGGCTCCCACCACAAAGAA
TTATCTAGCTCAAACTGTCAACAGAGCCAAAATTCAGGTGTCCTCCATCTGGGACCCTCA
GTTACAAGTGGGGGTGGGTATTTAGCCTGCAAGAAATGTTGCCTGTGGGGCCTGCTGCCT
GGCCCTTCTCTTCTAGATGGCTGGGCTTTTAAGAACAACGTGGACATCAAGAATCACCAG
AATCTCCAGGACCGCTTGCGGGCAGCCCACCTGCTGCTGGACAGGAGCCCCCAGTGCCCC
GTGGTGGTGGACACAATGAAGAACCAGAGCAGTCGGCTCTACGCGGCGCTGCCCGAGAGG
CTCTATGTGCTCCAGGCGGGCAGGATCCTGTACAAGGTGGTGACCTGGGGCAGGGAGCCC
AGGGAGGGCAAGGGCCAAGAGAGGGCTTTGGATCAGGCAGACGGGCATTCAAATCGCTGC
CCAGCCATTTACCAGGCCCGTGACCACAGGCAAGTCCTTTCCCTCTTGGAGCTTCTGTTT
CCTCTACTGCAAAATGGAGCTACTGGCCCCCACCCATGGGGGATGAAATAACACACAAGC
AAGCCCCTAGATTTTAGGCCAGAAGTGTAGCTTCCAGGCTGCCTTCTGAACCCCGAAGAC
TGGCCCAGCCCTGGTTTGGGTTGAAGCTGAGAGAGAATGGGGCTTCCATTTCATAAACGA
CGCTCAGAGAAGGGAACTCACATGCCCAAGGTCACACTGCACAAGGCTCTGATTTCAATT
CTCAGCCCTCTGGGATGGGATGGCAGTGGGAGGGTCTGAACCTGGAAGGGGGTGTAGAGG
CCCGAAGAGAACCAGCTCTGCAGTCTGGAGCTGGAGATGCTGAAGCAGGAATTCAGGACA
GGAATTAAGTCCCGGTTTCTTTCCTGGTGATGGTGTTCCCCTTCCAAGCTTCAGCCTGGT
GAGGGCGAGGGAAGTAAACACAGCCACTGACCCCGTGGGTATTGTTAGCCTCCTCCGAGA
GGACGATAACTAAGTTTTGTGGCTGCTGAAGGGATTTAAGCCTTGGCGGGCACTGAAGCC
CAGCCATGTGTATGCTCTCTGTTCACGGGTCAAGCAGCCAACAACCTGCAGATGAGTCCT
CAGGGCGCTGAGGGTCAAAGCATGAGGATTCGGGTCCTTCTTCCTTTCTCCTCCCCTGAG
ACACGCTAGGAAGGTGGCGTGGGAGAGGTGAGCTGGGTACCAAGTCCCTAGCCTGGCTCA
GGCCCTGTGCAAGTGCTGAAAGCCCGAGCACGGATCTAAGATGACCCATGCCTTACCTCA
AGGTGCTCCCAGTTGGGGCGGATGAGGAAGAAACGAGAGAGTGTCACCGAATCCCGATGC
CCTGACACTCCAGGGCAGGGATCAGCAAACCTTTTCTGTAAAGGGCCACATAGTAAACAT
TTTTGACTTTGTGGGCCAAAATGCTTCAGTTCTGCTGCTAGAGCACAAAGAGAGCACAGA
TGATCTTTAAACGAAAGCGTGTGAGGCATCAGGACAGATGTGGCTCTCAGACTGGAAATT
TTCTGGACCCTGGGGAAGGGCAGGCATTGTGGCTTAAAGGCTAAGGAACCACCCAGCCAA
ACACAGTAAGTGAAAACCATTGCAGATACAGGGGAGAGGCTAGGCAGAGGCACTGAGGCA
TGTCGGGCAGGATGCGAATGGAGAATTGGGGGCATTTCCGTTACAAAAGGCCCATTTGGG
GCCAAGGAGCCTGGCTTCTGTCTTAAAGCAAGAGAGAGCCAGTGGAGAGTTTTGAGCAGG
GAAGAGGCACAACTGGATCTGTACTTTAGAAAGATCATGTCCTATTGGGTGAAGAAGGGA
CTGGAGGGCGTGTGGCAGCAGCTGCCCAAACAGGACACGAAGAGGTTCGAACTGAGGCTG
TGGGATTGGAGAGGCGGAGGTGGTCTGATGCAGAGTGGGCAGGGCTTGATGTGAGAGTGA
AGATAAGGATAAGGCCAGTCTGCAGAAGAGAAGCTTATTTGTATAGACCCCTTTCCCCTT
TCTCTTTTTATTCCTGTTCACGTTACCCGCTCCGGTTTTCCTCCTGCTTCTCTATCCAGT
CTCCTCATTAAATGTGGGGGGCACTCTGCACACTCTCTCTTGTGATCTGATCCACCTCAT
GGGCCTCTGTCCTCCGTCCTTGACTGCACCCTCTTGACGACGCCCACAAAGACATTACCA
GCCCAGATCTCTCAACTAAGCTGTAAACTCACATTTTCCTGCGAGTTGGAAATGCTGATT
CATTTCTTTTGCAGGGTAAACCTGGCCCCTGGAACTACCACCCAGAAGAAGTTCGTGCTG
TTCTGGAAAAGCTCCACAGTTAATCTGGACAGATGCCCCAGTTCTAGGTGCCAAACAGGA
GGGCTCCTAAGGCTTGGCTCGCCCGCCATCCATCCCGGCTGATGTTCACCTCTTGACCTG
TGTCCCCAGCTGAATCACTGGTCAGGATCTTTCTTCTGTAAAGGGCCACATAGTAAACAT
TTTTGACTTTGTGGGCCAAAATGCTTCAGTTCTGCTGCTAGAGCACAAAGAGAGCACAGA
TGATCTTTAAACGAAAGCGTGTGAGGCATCAGGACAGATGTGGCTCTCAGACTGGAAATT
TTCTGGACCCTGGGGAAGGGCAGGCATTGTGGCTTAAAGGCTAAGGAACCACCCAGCCAA
ACACAGTAAGTGAAAACCATTGCAGATACAGGGGAGAGGCTAGGCAGAGGCACTGAGGCA
TGTCGGGCAGGATGCGAATGGAGAATTGGGGGCATTTCCGTTACAAAAGGCCCATTTGGG
GCCAAGGAGCCTGGCTTCTGTCTTAAAGCAAGAGAGAGCCAGTGGAGAGTTTTGAGCAGG
GAAGAGGCACAACTGGATCTGTACTTTAGAAAGATCATGTCCTATTGGGTGAAGAAGGGA
CTGGAGGGCGTGTGGCAGCAGCTGCCCAAACAGGACACGAAGAGGTTCGAACTGAGGCTG
TGGGATTGGAGAGGCGGAGGTGGTCTGATGCAGAGTGGGCAGGGCTTGATGTGAGAGTGA
AGATAAGGATAAGGCCAGTCTGCAGAAGAGAAGCTTATTTGTATAGACCCCTTTCCCCTT
TCTCTTTTTATTCCTGTTCACGTTACCCGCTCCGGTTTTCCTCCTGCTTCTCTATCCAGT
CTCCTCATTAAATGTGGGGGGCACTCTGCACACTCTCTCTTGTGATCTGATCCACCTCAT
GGGCCTCTGTCCTCCGTCCTTGACTGCACCCTCTTGACGACGCCCACAAAGACATTACCA
GCCCAGATCTCTCAACTAAGCTGTAAACTCACATTTTCCTGCGAGTTGGAAATGCTGATT
CATTTCTTTTGCAGGGTAAACCTGGCCCCTGGAACTACCACCCAGAAGAAGTTCGTGCTG
TTCTGGAAAAGCTCCACAGTTAATCTGGACAGATGCCCCAGTTCTAGGTGCCAAACAGGA
GGGCTCCTAAGGCTTGGCTCGCCCGCCATCCATCCCGGCTGATGTTCACCTCTTGACCTG
TGTCCCCAGCTGAATCACTGGTCAGGATCTTTCTGATCCAAGCAAACAATTGTTACAATG
CGAAAACGAAGCAAGCTGAGGGCTAGAGAAGATACGACTCCACACCGCCCCCTCCAGGGA
AACCTGTATATTGCACATCTCAGCGTGAGAGTAGGTCCTCCCTGGGCTTACTTAGGAGGG
GTGGTCTCTCTCCAGCCACTTTGCTATGGCATTTCTTAAACAAAGTAATTTCATTTCACC
AAGTTTGCCATTTATGGAATTGATCACTTAAGACACTAAACTGGTTTTCAGCACTAAGCA
TGGGAGATCTCCGGGTGTTTAGAGAGTGATGAAGAATTTAAAGGGAAACGAGAAGGAATG
GGAATAGACCTAAAGATGGGAATCCTTTCCTTTAGCAAAAGATTTAAACCAGAGGGCGGT
GGTGGTGATGAGGGGTGAGTTTCCATGGCGACATATCTTCAATTCTAATGCAGAAGAGGA
GGGTACTCTCTTTACCACCTTTGAATACATTTCAGAGAAGCCTGGCTCACTGTCCCTGGA
AAACTAACACTGTCTTCACTTATCAAGAGTCACCTGGGAGGAGCACTGGTTCCGGGAAAC
CCGTATACCCTTGACCGAACTAGACAACGGTCACTACAAAGCTGTCATTCAGTTATACAG
AAGCTTATATTTGAAATTCTGTTTCTCCACTTCCTTCCCAAGTCTCCTAATGGTCATTTA
TGTTAGATTACATCAGACTAATGGATAACCATTGGTATTGATCTGTTTTAACTCTGCTTC
TTTTCATATTTGTTTATGACGGCCACAGCCTAAAGTACACACGGCTGTGACTTGATTTGA
AAGGAAATGTTTT
Chart Advanced