SelenoDB
Release 2.0
Chart Advanced
Transcript Report for SPT00002301_2.0
Identity
TranscriptSelenoprotein O (SELENOO)
SpeciesPteropus vampyrus (Megabat)
Transcript IDSPT00002301
Transcript release2.0
External IDNone
Gene SPG00002208_2.0
Annotation
Prediction method(s)
(Selenoprofiles, Ensembl 68) [Report annotation error]
OrientationForward
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Full length Spliced 5UTR CDS 3UTR
 
Sequence
>SPT00002301_2.0 # Transcript # Selenoprotein O (SELENOO) # Megabat 
ATGGCCTCTCTCAAGGCTACGCTCGGGGCTTCCCTCGCGGCCGCCCGCACCCTGTCGCCG
CCCCTCGGTTGCCGCCCGCTGCCCGCGCTCTGCTCTGCTTCGGCGGCCGCCCGCGGCGCC
GCCATGGACCCGGCACCCCGCTGGCTGGCGGGGCTGCGCTTCGACAACCGCGCCCTCCGT
GAGCTGCCCGTGGAGACGCCGCCGCCGGGCCCCGAGGGCGCCCCGTCCACGCCGCGGCTC
GTGCCCGGGGCCTGCTTCAGCCGCGTGCGGCCCGCGCCCCTGCGGCAGCCGCGCCTGGTG
GCGCTGTCGGAGCCCGCGCTGGCACTGCTGGGCCTGGGCCCGCCGCCGGACGACCACGCC
GCCCGCGACGCACGCGAGGCCGAGGCTGCGCTCTTCTTCAGCGGCAACGCGCTGCTGCCG
GGCGCCGAGCCCGCCGCGCACTGCTACTGCGGCCACCAGTTCGGCCAGTTCGCCGGGCAG
CTGGGCGACGGCGCCGCCATGTACCTGGGCGAGGTGTGCACAGCCGCCGGCGAGCGCTGG
GAGCTGCAGCTCAAGGGCGCCGGCCCCACGCCCTTCTCCAGGTGGGCGCCCATCTCCAGG
GCCGGGCCGGGCCGGGGCTCGGGGCTCGGGGCTGAGGTGTGCTGAGCGCTGGAAGGCCCG
CCCCACTCTCTTGGCCGTCTGTGGGGGCGTGCGCGTGCCGGCTGAGCTGTCCTTCCAGCT
GGGGGTTGAGATGTGACGCCGGGAAGATTGATCTCGGGCGGAAAAATACGGAAAGAAGCG
TCCTGGCAAGGATCAACTTGCGGGAAGGAGCCGAGGCCAGGAAAAGTAGTGCTGCCGCCC
CAGGACCCCGACTCCCCCTGGCTGGCTTGTCCAGANNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGAAAAACCTGCACACAATTATAGCAACTTTATTCACAATTGCCAA
CACTTGGAAGAAACCGAAGTGCCCTTCAGCCCGTGATGGATAACCGAACTGCCGTCCACC
TGACAGGAGATCCTCAGCACAGAAGGGATGAGCTCTCGAGCCGCAGGGAGCCTGCCGGAG
CCTTTGGTGCACGTCTGTGAGTGAAAGCCCAGCGAGCGGGTGGCACGCCGTGCGACTCCA
GCTCGGTGACATTCTGGAGACGGAAAGAGTCGGGGTTACAGGGTTAGAGGGGAGGAGTGG
ACAGGTGGAGGACAGAGGACTTTTAGGGCAGTGAGACTTCTCTGCATGACGCTCATGGTG
GGTACGTGTCATACGTTTGTCAGAACCCATAGGACATTCAATACCAGGAGTGACCCTACT
GTGAACTGTGGACTCTGCACGATAATGACATGTCTGTGTCGGGTCATCGGTTATCGCGGA
CGTCCCGGTCCTGAGGGGGACGCTGACAGTTGCAGAGGCTGTGGGAGGGAGGGGACGGGA
TATACAGGAAGAGCACCGTCCCCTCAGCCTTGCTGTGAAAAGCTGTCTGCCAAAACATGC
TAATAACAGAGGCCCAGTGCGACAAACGCTGCTGCCGTGTGTGTCCCTGTACACGGTTTG
TAAAACCAGTCCTAAAAGCAGCTGCAGGTCCACGAGCGTGTGTGTGACACGGTGAGCGGG
TGGACCTGCCCTTCACTGTCCCTAGCATCAGTCCAGCCCCGGCTGCAGGCCGGGCTTGTC
ACCGTGCTGTCATCTAAAGTAAACTCTGACGGTGACGTTGGTGCTGCTTGTGAATTGTGT
TTGAAACAGCTTCGGCGTGTCCATTCAGTCTGTCCCTCTCGCTGCCCAAACTGCAGGGTC
AAATGGACGCCCGCCTGAGCGGCACAGTGACCTCTCTGCTTGATTCCAGACAGGCCGATG
GCCGCAAGGTCCTGCGCTCCAGCATCCGGGAGTTCCTGTGCAGCGAGGCCATGTTCCACC
TGGGGGTCCCCACCACGCGGGCAGGGGCCTGTGTCACGTCGCAGTCCACGGTGGTGCGTG
ACGTGTTCTATGACGGTAACCCCAAGCAGGAGCCGTGCGCGGTCGTGCTGCGTGTAGCCC
CCACCTTCCTCAGGTAATGCGGGGCTCTCGCAGCCAGAGGCACCTCGGTGACACGTCCAG
AACCTGGCCCTGGCCAGCCCTGGCACAGAAGCAGGGTGCTGTGGGGGAGACGTTTTGCAC
TCAGGGGGAGGGACTGACGGGCCAAAGGCACTGGGCACTTTCTGGGTTGGGAGCCCTGTC
CTGTGTGGGGACAGCCGGGCTGTGCCCTTCCGCACTGCGTCCTGGCCCTGTGTCACCGGG
AGAGCTGGGGTGGTGGTTCAGTCGTGGCCAGAGCTCAGCTGGCCCAGGAGAGGCCTGAAG
GGCCCAGGACTGCCAGAGGGGCTGTCCCTACACGGGCCCTGAGGTGGGGTACATACAGAG
CTGTTCACTTAGACTTTGTGACAGGGAACAACATGAAGCTCACCCAGCAAATGCTCTCGC
TCTGCGTCATGATGACAACTGACTTGTCTTCCTCACCCATTCATTAATGTCTGATGTCAC
CGTGCTGCGTGGCATCAAACACAGAGTTATCAGGAGGTGGATGTGGTGATCTTGTGGCTA
AGCCGTCCTGTGGGGCCAAGCTGACCCTGTACATATCAGAGCAGCCAAGACAGCTCAGCT
ATCTCCAGGCCAGTCCCAACCTTTCTTGTCTTCTGAGGTAGTGGTCCCCAACCTTGTTGG
CACCAGGGACCAGTGCTCCTATGAGAATCTGGTGCCCAATGGTCTGAGATGGAGTTGAGG
GGTGATGCCAGCACTGGGGAGCGGCTGCAAACACAGATGGAGCTTCGCTTGCCCACCACT
CACCTCCTGCTGTGCGGCCTGGTTCCCAGAGGGCGGTGGACCGGCACTGGTCTGCAGCCC
AGGGGTGGGGGACCCCTGCTCTGAGGGATGGGGGAGCCAGGAGAGAGGTCTGCCTTGTCC
TTGGAGACCCAGGGCTTCTCCACGGTGGCACCACTAGGCAGTGTGCATAGCAGACAAGCA
GCTGATGCTGTCACCACACTTCAGTTAGCACTTGAGCGGAGTGTCCTTAGCTGTGGCAGG
ACAAGCACAGGGCCCTTCTCGTCCTGTGGAGTCCGGGAGAGACGACCGGGGCTGCGCAGA
CTTTGACTGAAAGTGGACAGAGCCACGGAAAGACTGGCCGAGCTCGTTCGAGGGGACCAA
GGCCTCCCCGGGGCAGGCGCCCGCCTCCCGCGTAGGCAGGAGGCTGCGCTGACCACGGAA
ACCCCGCCCCTCCAGGTTCGGATCCTTCGAGATCTTCAAGCCGGCGGACGAGCACACGGG
GCGCGCGGGCCCCAGTGTGGGGAGGAACGATATCCGCGTTCAGATGCTGGACTATGTGGT
CAGCACGTTCTACCCCGAGATCCAGGCCGCCCACGCCAGCGACAGCGTGCAGAGGAACGC
CGCCTTCTTCCGCGAGGTGGGCGGGCCAGCCCCTCCCTGGCCATGCTGGGTCTGCGGGCC
TGATCCACCAGCCGTGGGCGCCATGCAGCTGCCCCCGCCCACCTGGGCTGCACCTGGGCC
AGGGGATGTGGCCAGCGCCCAGTTCATCCCCGTGGCAGGCAGGGAGGCGGGTCGCTCTGC
CCTGTGGGCCTCCACATGTCCATCAGCAGAGCAGAGAGGGGACCCTGCCAGTGCCCAGGC
GCCCTCAGCTGCTCAAGAGGCACGGCGTAGGTGAGGCTGGCAGCTGGGCCCTGGCCTGGG
CGGGTGGGCCATCTGAGCCCCTCCCCTGGCCGCGGGGCACAGCCTGGACCTCGGCAGGTT
TGCCTGTAGTCTAGGTACCTTGTTTGGTCGTCCGCTGGGTCCAAGTCACGGGAAGTCAAG
GTTTCCTCGTTTTTCTTGTGGGTAAGAGCCACTGTGAGCACCTGGGAGCCAGTGCGTGGG
GACTGGATCCTGCGCGTGACTCCTCCAAACTCGTCTCCTCCAGCCTCCCAGGGCCCTTCA
CGGCTGCATGCTGGACGAGAGGGCGGTGTGCTGGGGCGGAATCCCCATTGAACAGCTCGC
TCCAGGGACTGAGCGAACAGGGGAGTGGGAGGCTGGAGGGAGTGGACAGGCCTGTTTTGC
TGCAAGTGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNTGTAAAAGGATGTTTTCTATTCCAGGCGCAAAGGGACCGA
AGGGCAGGATCGGGAGCAGGTAGAGGGTAGCGCTGGCCCGGGCTGTGCGGCCTCCCTGCT
CTTAGGGTGGAGCCATCGGGGTCCTTGGGGACAGGCAGGAGAGCGGTGGCCATGTGGGCG
CTTGGGTGCTACCAGGGAGCTGCACTGTCCCCTCGGCAGCACCATGGTTCTCAATCTGAG
TGGCAGGTATGACCCTGACCACGTGTGCAATGCCTCCGACAACGCCGGGCGCTACACGTA
CAGCAAGCAGCCTGAGGTGTGCAGGTGGAACCTGCGGAAGCTGGCCGAGGCCCTGGAGCC
CGAGCTGCCCCTGGCGCTGGCCGAGGCCATCCTGGCCGAGGAGTACGACGCCGAGTTCCG
TAGGCACTACCTGCACAAGATGCGCAGGAAGCTGGGCCTCGTGCGGACCGAGCAGGAGGA
GGACGCCGCGCTGGTGGCCAGGCTCCTGGAGACCATGCAGCTGACCGGTGAGTGCGGGCA
GCCACACGGGCTCAGAGTTTTCACCGCCATAAAATGAACAGGACATGACCTTGACCCTTA
ACCTGTTTCCCTGTGCTCGCCAACCAGTGGCATTAGGTGCACTCACTGCTGTGCAGCTGT
CACCACCAGCACCTCCAGAACATTCCATCTTCCCAAATGAAGCTCCGTCCCCATTAAACA
CTCACTCCCCACGACCCCCCCACCTGTCACCCACTTTCCTACTTCCTGTCTCTGAATCTC
ACCCCTCTAGGGCCTCACAGAAGTGGAGCCACACAGTGCTTGTCCTCTGTGCCCTGCTGG
GCTCCCGGCTCGCGCTCGCGGCCCACCCCCGTTAAGCTTGAACCATCTACAGATGGACCG
TGCTTTGCTCGTCCACCAGCCGTCGATGGGCACTGGGGTGGTTTTCACTGTTAGCTGCTG
TGAACGCACATGTGCAAGTGTCTGAGCCCCATTCTCGGCTCTGCACCAGGAGAGGGCTCC
TGGGGCACTGTGCTGCACGACTTGCTGGTGGCAGCGTCGCCGGTCCTGATCTCGGGAAGT
GCCGAGCCGGCCACCTGTGGCCTTTCCATACACACCCTTCGTCAGGTCGAGGCAGTTTCC
TCCTCTTCCAGTCTGAGTGCCTGGGCCATTTTGTGTCAGTGAGACAATCACATGGGTTTA
CTCCTTCGTCCCCAACTTGTCCGGGTCACTTTAAATTGCTGTGGTGAATTTGAGGCCACA
GGCGGGGCCTCAAACCGTAGACATTCATTTCTCACGTGCAATCCTGGAGGCTGTGAGTCG
GAGGTCGAGGCGCCAGCGGACTGTGTGGTGCCGTCTTCCTGCAGTGTCCTTCCGCCAAGG
ACACAAGTCCTGTCACCGGGCCCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGT
ATGTTTCAGTGGCGGCCCCCGAAGTGGGAAATGGCTGCAGTGACATTGCTCAGGGCCAGG
GGCCAACCTCAGTGCCCACACTATTGTACCCATTTTACAGATGAAGAAACCGGGGCTGGT
GGCTGAGCTGGGTAGGGGCTGAGGAACAGGCTAGAAGAGGGTCCAGAGCCCTGGACCTGA
TGCTGACTAGGGCTCCTGCACCTGTGTTGGGGGGATGGGTGTGGGCCAGCGCGAGGCTGG
TGCCACAGGAGGGACATGCAGGGCCCAGCCCCCAGCACCAAGTGCTCTGTGCTCCAGGCG
CTGACTTCACCAACACCTTCTGTCTGCTGAGCTCCTTCCTGGTGGGGCCGGAGGCACCAG
GCCTAGACGACATCTTGACTGCGCTGACCACACAGTGTGCCTCCCTGGAGGAGCTGAGGC
TCGCCTTCCGCCCCCAGATGGACCCCCGGTGGGTATGCGGGTCTTGTTTCTTTGGAATGT
TTGTAGAAACGCAGGATGGTCAGGATAGCATGGGGGCATGTGCACATCAGGGAACATGGG
ATAGTTTTCTGGGTACCTAGGGGTTCAGGGGGCTGTCCCACTCCCAGGACTCGGGGATAG
TTACATCCCTGGGACACCAAGGCCCATTCGCTGGTCACAGGGCAGGCCAGCGGTGCTGAT
GCTGGCACGGGCGAGTCACATGGGACAGGCTGGGAGGCTGGGCTCTGCGCCCCAGCAGCT
CCCCGGGCCAGCCCTCAGGTCCCTGTCAGAGCACGCTCTGCACTGTCCCCCACTGGGTGT
CGCCCACACCTGGGGAATACCTGGAAGTATGGCTGTAGGACTTGATAAACAAGCCAACAG
ATTGTGGTCTGAGAAGAATTTAGTGCAGCACTGGGGAGTGAACTGAAGCTCAGGGTGCAG
GACCTCCGGAAGGAAGCCAGTGAGACTGGGCGAGGGGTGTCAGGCTGTCCCTGACCCCCA
GACGCCTTTGGGAGTGGGGAGAGATCCAGCTTATGGTCATTATGGGAAGAGCTAACAGCA
GTTACCTTCTCCCAGAGGAAATCATTGCTGGGTTGGGACAAAGATAAGGGGGGCGCCAAG
CAAAAAGATGGCACCTGACTCCTCTTTGGGATGGGTGCCCCCCCACACCCCAGGGTCTGC
CCAAGTCAGCGGCGGTCGCAGTTCCTCAGGCGGGTGACTGGCAGGTGCCCCCACGTCAGC
GTCATCTGTGAGCCGCAGGCAGTGTAGCAGGGCAGCTGAGACTGTTGCCACCGCCTCTGT
GCCAGGATAGTCATCACCAAGGTGTCCGGCGGTCCCAGGCCACGGCCCCAGCCAGTGGTG
GGGGCACTGATGCCTGCCAAGCACACTCACGCGGCCACTCCACGCAGGCAGCTCTCCATG
ATGCTGATGCTGGCGCAGTCCAACCCGCAGCTCTTCGCGCTCCTCGGCTCGCAGACAAAC
ATCACGAAGGAGCTGGAGCGTGTAGAGCAGCAGTCGCGGCTCGAGCAGCTGAGCCCAGCG
GAGCTGCTGAGCATGAACAAGGACCACTGGGCCACTTGGCTGCAGGAGTACAGGTGAGGC
CGGCCCCACCCGCCACCCAGTCGCGAGGCTCTGGGTGCTGACTGCCTGTAGTATCACCTC
CCCCGGGGGTAGCTACAGACAACCCCTACCCAAGGATCCGCATGGAGGACGACTGGGGGC
TTGCATATGATTCCAGAGCCCGGCTGGAGAAGGACAGGGAGGGTGCCGGGGACGCCGCCG
CCTGGCAGGCTGAGCGTGTGCGTACCATGCACGCCAGCAACCCCAAGCACGTGCTACGGA
ACTACATCGCGCACAGGGCCATCGAGGCTGCCGAGAACGGAGACTTCTCAGAGGCAAGGG
CGTGCCTGTCCCTGCTGTGTCCCTGGGTCCCACAGTAGGGGGTGGGCTGGGGAGGGAGGG
GCACCCCCACAACCCTGCCTTGTTCCCCCAGGTGCGAAAAGTGCTGAAGCTGCTGGAGAC
TCCATACCACAGGGACACAGAGGCCCCCGAGGTCCTGGATGCCACCGAGCCTGAGGGGGC
GGGCGGGGCAGGCGGGGAGGCTGGCGGGCGAGGCTCTTACAGCAGCAAGCCCCCGCTCTG
GGCTGCGGAGCTCTGCGTCACCTGATCCTCG
Chart Advanced