SelenoDB
Release 2.0
Chart Advanced
Transcript Report for SPT00002238_2.0
Identity
TranscriptGlutathione peroxidase (GPx)
SpeciesProcavia capensis (Hyrax)
Transcript IDSPT00002238
Transcript release2.0
External IDNone
Gene SPG00002145_2.0
Annotation
Prediction method(s)
(Selenoprofiles, Ensembl 68) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Full length Spliced 5UTR CDS 3UTR
Forward Reverse  
Sequence
>SPT00002238_2.0 # Transcript # Glutathione peroxidase (GPx) # Hyrax 
GACAGGCACCAGAGAAGCTTCTGGTGGAGTCCGACCCAGAGGGGCTTTGAGACCCACCAT
CATTGATATGTCCCTCCACTCACGTGAGGTGAGGTTCCTACTCTCACCCTACTTTCAAGA
GGTCCTAGGGGACAACTACAGGGTGTCAGGGGTATGATGGAGGACTGTGTAGGGAAAAGA
GGAGTGTCACGATGCATGCCTAATTTCTAGGGGACAAGAGGCTATAAACGGGACCTAGAC
AGTCTTGTCACCAGTTTCTGCTTTCTTTAAATCTAGATGATGAAAAGTGTCAGAACTTCG
GATATCACTCTTTTAGGAGCGTGGGATAATCTGAACTATCTATTTTAAAGGATAATTTTC
CTTTGGAATGGACTGGAAGAAAAATCGATACTTTGGGAAGACAGAATTGGGGAGACAGGT
TTTCCTTCCCTTAAAACACACACATACCCGGAGGCACTTGGGTAGTACAGGATGGTTTAG
TTATATGTAGGCTGAGTTGGAAGAAACATGGAGTAAAGATGTGTTCTTTGTTAAACAGGT
CCTTCTGGTGGGAGGCAAGGTTGCTACTTTCGCCACTCTCTGGCTCTTCCTACTTGGTTT
CAAACTGCTTCAGGTACTCAAGGATGTCTGCCTTGACTGTGCTGATTGGAGCTTTATGAT
ACCAACGCATGACAGGGACTCCATCAGGTCCCACCAGAAACTTCTCAAAGTTCCAACGGA
TGTCATGGACCTTCATGGGCTCCCAAAAGAGTTGAGTTGGTGAGCCCAAAATCTCAGAGA
GGGGAGGACAGGAGTTCTGGAGCAGAGATATGAAAAATAAAAAGATAAGTTTATTTCTCC
TTCTGTCAGTTCCCTCTTGCCAGATAGTCTACTCACTGTAACACATCTTAATATATTAAT
TACCCTACATGCTCCCAGGCAATCACACACATTTCAATGAATCATCACCAACACACCAAC
CACAACTCAAGCAACTAAGAGTCAGAGACCATGGTGCTAAACAGATAACATTCCTCCTTT
TTCTGTTTCTCCCTATTTCTGTGACTACATCATGATGCTTCAGCAAAAGAATAGACAATT
TGTTTAGACTTAGTTTCCTTAGCTGAAAAATAATGGCTTGGATTAGGGTAGTTGTTCCTA
GAGCCTGGGACTTCATAGGACAGTAAAAAGTTGGGGAAATATATATATTTTTTGAAGTTA
AGGTAAATGAACCACAGTCATCATGACAATAAAAACTTTTAAATAAAATTAAAATGTAAA
AATGAAAGGATTTTAAAACACTAGGCTTAAACCAAAACCCATGATTTTAACTCATGGTGA
CCCTATGGCACAAGACAGAACTGTTCCAGAGAGTTTGCCAGGAGTGCCTGGTGAATTTGA
ACCCCAGAACGGTTAGCAGACATTAGGACTTAACCACTTCACTACCAGGATTTCCAAATG
TTAGGTCGAACCATATAAAATTTCTGTCTCACCATTTTGAATGACAAAATTGGCAATTTC
ATATGATTTAACCTAATTTTAACTTCATATCAGAATAAGTGACGGTCTTTTATGTTCAAT
TAAGTCAAGCTTTGTGGGAAAACTCCCAACACTTTCCTTTTTTCTCATTTTGGTGTGAAT
GAGTGAAAATTTCAACAAGCTCCAGCCTTACTCCATTGGCCAACATTTGGAAATCAGTAG
ACTAAGAGATCCACAGGGACCCTTCCATCCTGGTTTTGCAGTTTTGGTATTTTGTGACTC
AAAAGGCACTACACTGCAGTTAACACTACCGTTTCGGTTTGTCTGCCAGCTAGGTATGAG
CTCCTATTAATATATGTTAACTCATTGCATAACATCGTTCTTTGTATATAGTAAGGATTC
ACTAAATAATTGTTGAATAAATAAATTACTACTATTCAGCAGAGGGGGTTAGACCACGTA
ACAGTGGACATACTCTGGTAAAAAAAAAGTTTACGATACAGACATCATCTGTTTTCCCTG
CTTCAAGTCATAGCTCCGCAACAGTTGTTGCCGTGATCCCTGAACTTACTTGAGCGTCTC
CTTCCAAGGAGTCCCCCCACAATCCTAGACATGAGCCCCACAGCTTTAAGCGCATCTCTG
TCTGAACAATCCACACTACAATGATATTCACTCACCTTCAGGAAAGTATACACCTTCTGT
TCTTTTTCGCCATTCACATCCCCTTTTTCAAAGAGCTGGAAATTGGGGACAAAGCCACCA
CCTGGGCGCACATACCTGCAATGAACCCAAGTGTTCTCAGGAGGATCCAAATTAGGACAA
GGATGTATACTAATGTCTACCACAACTTTCCTTGAATACTCTGGGCATCAGTTCTACCCT
GGCCCCTAGGGTCGCCATGAGTCGGCTCCGACTCCACGGCACTTGGCTGGCGACCACAAC
TTTGCCAAAAAAAAAAAGGAAATGAGATGAAAAGGGAGAGAGGTGGTAGATAGGGAAGAT
GAGGAAAGAGAGGTCTCTTGGTATCAGAACTTCGTGTGATAGGCTTATTGGAGCCAACAG
AGAATTCCAAGAATATTAGGTCTTATTTGAGCATAAATACAGGAAGGGGACATGAACTCC
TTCTCATCCCTCTTGGTCTCCTCATGATTCACTTCCACTTCATTCTCCGTATTCCCTCCT
TTCCCCTATCCTCCTAACCCTGCATCCAGAATCTCTGTGCTTCTTTTGCATTATATGTTT
CCCTGGTCTCACCATCAAAGAACCCAAAGTTAGTGAGAATAGCATGTCCCAAAAGCCAGA
TGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNTTAATCATTTTTAGGTCATATTTATTAGTTCCTTTGATGAAA
ACCCAACTGGTAACATTCAAACTCAACTCTACTTGCTGGTGTTTGCCTTAAGACCATTTT
TTTAGATAGAGAGTGACTTTCTATTTTTGTATATTTCTTCAGTTGCTGTGCACACTCACC
TCCCTCTTATCTTTAGCAATCAGGAATGCTTCCCTCTTATGTTTAGAAGAAATGGAGTAC
TTGAACGGAGCAAACAGCTAACATGTTTGGTTGCTAACCAAAAAGTTGAAAGTTTGAGTC
TACCCAGAGGCACTTCAGAAGAAAAGCCTGGTAATCTACTTCTGAGAAATCAGCTATCGA
AAATCTTATGAAACACAGTCCTACCCTCACACATGTGAGGTCAGATTGGTTTTGATGGAA
CTGGTGGGTTGGCTGATATAGTAGAAATACTTCACAGACCTTGATTCTGGTCCTTGGCAA
GTTACTTTAACTGTCTCAATTTCCTCATCTCGACTGTAATTTGAAAGAGATACACTTTAA
AAGCCTCTTTAACTAGGTAATTCAATAAATCATACCACAGCAACATAATGGAAAATTCTA
TAGCTTAAAAGTGAATGAGGAAACTCATCCTGTGTTGATACAGAATAATCTCCAAAACAT
TTTATTTTGCTGTGTGAAAAAGCAAGGTGAAAACGGTCATCTAAAGGAAAAAGAACATCA
AAGATTTCATTGTAAACATTTTTGTTATCTTTTGAATTTTGTAAATACATTACCTATTCA
ACACATAACATGTTTAAATTAATCCTAAAGCAGAAAATAAAGTACTTGTCATATCAAGAA
CAACATCTGTCTCTAGTACAATCCATATAGAACTCTAGTTCACCTTTTCTGGATAACCAA
GAAACTCAAATTACTCTTGATGAGTGCACAAAGAAAGAAAAATTCGTATCAGCCACCGTA
GAGGCTGGGCTGAGTTTGGAAGGATAGAGCAGTCTCCCCTATCACCAGTCACCTTATTAC
CCTTTGTTCTACTGCAGCCCAGATGGGCAACCACATTCCCTTCTTTGTCACTTGGAGACA
CCTTGTCGAACTCAGTATCTTTTTCCAAAAGATAGTCTTCTCTCCTTGTTGTTAACAGGA
GTCCACAGTGAGAAAAATAAAAGCAGCCCCTTGACAGCAGGAGCTAGCTGGCAATCATAG
CTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGTGCAGATGC
GGTTTAGTAAGGTATTCATTCATAGAATTGACTCCATTTCCTGACAGCATCCAGGAAAAC
TTTAATTCCTTGAACTCTCACCCAAAATCCTTAACATAAGCCCAGATCCTATAGTAAGTC
CTTTCTAATGCTTTACTGAGAAGTCCTAGGGTTTCTTACAGTATATAGGGGGCACTGAGC
AACAAACTCAACTTGTTCAACTACTGATGTGTTCCTGGTCGTCTTTGGTTCAGTGTTTGA
GATGGTTTTCGTTCTCAGGTGTAGACATAATTCTCCTGGCAGTCTAAGGAGCAGAACAGT
GGTAGGACTTAGGGGAATGGAATCCTATCTCTCCTCTGCCCCCAAAAGAATACATTAGCA
GAAATTTCTTGAATTAGAATATGGCTGTGTGAAACATGAGTTCTTACCAGGATACTGAGC
TGTCAAGCCTCAATAGGTAGCCACGTTGACAAAGAGGACGTGCTTGCCCGCATACTTCTT
GAACTGGATATATTCCTCGCCGTTGAGGGTGAGGGCTCCATACTCGTAGACATTGCCTGT
TACCCCTTTGTAGCAATC
Chart Advanced