SelenoDB
Release 2.0
Chart Advanced
Transcript Report for SPT00002103_2.0
Identity
TranscriptIodothyronine deiodinase 1 (DIO1)
SpeciesPelodiscus sinensis (Softshell turtle)
Transcript IDSPT00002103
Transcript release2.0
External IDNone
Gene SPG00002010_2.0
Annotation
Prediction method(s)
(Selenoprofiles, Ensembl 68) [Report annotation error]
OrientationForward
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Full length Spliced 5UTR CDS 3UTR
 
Sequence
>SPT00002103_2.0 # Transcript # Iodothyronine deiodinase 1 (DIO1) # Softshell turtle 
ATGTTCAAAGTTAGGGTAATTTTACAAAAAACCTTGATTCTTTTGTATGTATCTCTGTGT
GTTGCTGTTGGTAAAATGCTGATGATATTATTCCCAGAAACGATGAAAAGACATATTCTA
AAACGAGGACAAAAGAGCAGCATAAGCAAGAATCCAAAGTTCAGCTACGAGAACTGGGGC
CCAACTTTCTTCAGCTTTAAATATTTACTCTTTGTTTTGAAAGTGAAGTGGAAAAGGTTA
GAAGATGAAGCATTTGAAGGACATAATGCTCCCAACACCCCGGTAGCAGACTTCAGCAAT
GAAATACATCATATCTTGGACTTCATGCAAGGTCAGTAAAATAATCCAAATAGGTTGGGT
CCTCATGATTAGAGTAGTAAATAAAATAGAGTATTCAGACTGACTGAGACATGTTATTTG
GAGATTAGGGAGCTAAGTGATGATTTGAGGGTCCAATTACAGATTCTGCAAACCAGTTTA
GATTAAGAGCAACTAGCTGCAGAGGGATTTAAGTAGAAAAGAATAGATCACATTCTAAGG
GTACATCTAAACAGCAGTGTTATTTCAGAATAATTGATGTTATTCCAAAATTATGTAGTT
CACGTCTACACTACAAAGTTATTTCGACAATGTCAAAATAATGTTGAGCTGGAGGACTTC
CTACTCTGATTCCTGTAACCCTCATTTTATGAGGAGTAAGGGAAGTCAGAGGAAGAGTGC
TCTTCCTCGGACTTAATGCTCTGTAAACAGCATCAAAAGCCAAAATAAGCTATTTTGACT
TAAGCTATGCAATTGATGTAGCTGAAGTTGAGTAGCTTATTTCGGCTTTAGCTCTGCTGT
GTTGAAATGTCCTAACAGTGGAGTTTCTCAATCATGTACATGCATTGGTGGTTTTAGAGA
GAAATCTTTGTCTTTGAAACTGCACAATTGTATGCAGTTTTCCAATGCATACAGGTATTA
CATTTGTTACTTATTGTCATGGATTGGGAGGGAGCATCTGTCTACTGAAAACCAATATCA
TAAATTATCATGGTGAAAGAGGCAAATATAACCAGAACTATTTACTTAATACATTTTGTA
TACTGTTACACACAAGTGGAGAAAGCCCATGCATATTAACCAGACTGAAGTGCAGAAAAG
ATGTTTGTTAGTTTCCAAATGAACACAAATAATGCTGACAGAGAAAAACTGTTTTGTACT
TTGTCTTCCACTTTGATGTTTGCAGCATACATTATTAATCATTAAGCTGCATTATCTAGT
TCCATGTATATTAACCAGGGCTTTAAAAAACCCCAAACAATCAATTTCAAAATTGATACA
GCATAGGAGGAAGGTATGCACAGTGTATTCAGAGATTAATCCAAGATTAGACCATTTTGA
AGTGGGAGAATGATAGCATCACATTTTGAAATTAAGCACAGCCAATGTTATTAAGTCATT
AGGAACACTCTTTAAATCAAGGTCCTGCAAACACAAGAAAGTATTCCTGTAAATATTTGT
GCAGAGGTTTTTTGTTAGGTCCATGCATAAGCATTTGGGGAATCAGGCCCTTAGCAGGAC
AGGAAATATTTACTTCCATGGCTTGAACAGACTTTGTTTAATAAATAGTAATAATGAATA
CTTAGAATTCTGCCTGGGCAAGAGGATTGCTGAATCACATTGAAATCATGAAAGCCTAGG
ATGCATTATTAAAAATATAGCCAAAGTTTTCAGATCTAGCTGTCTTATAACTAGGCTCCT
CCTATAACAAAATGTAGGCACATAAATAAAAAAGAACTTATGTTCAGAATTTGTAACTTC
CCCAACACCAACTGGAGCTGTGGGAATTTAATATTTAGGTGCCTAAAAATGGATTTGAAA
GTCTAAATTTAGGCATTCAGGTTTGAAAATTTGGGTCTTTGAAAATCTGGGTCTTTATTC
TTTAAGGAACATGCAGAATATTTTAAAGTACCTTCATACTAATTTGCTTTGCAGTAGCGT
TTAGAGACCTCAGTTGAGATAGAGGGGCTATTATTTTGGTTGCTACACATTTACTAAATT
AAGAGTTCCTCCACCCGCAAGAGGCTTACAGTCTAAGGCAGGAGTGGGCAAAAGGGCCTC
CGCGGGCCAGATCCAACCCACTAAGTGGGTTGATCCAGCCCACAGAGGCCCTGCTGCTCC
CCCTCCCCCAGATCAATTAGGGCCTGGGAGCAGGGAGAAGTGCGTGAAGTTTCCTCTGCC
CTGCAAGGAGTGCAGGGCAGGAGGAGACTTTGTGTGCTCCCCCGCCCCCAAGGCCTGATT
GACCTGGGGGCAGAAGGGGGAGCATGTGAAGTCTCCTCCTACTGCCAGGGGCATGGTCAC
CTAGGGGGAACCTCTGGGGGGAGGGGCCAAAGACTTCACATGCTCCCTCACCTCCAGACC
AGTCATGATCTGTGGGTGGGGAAGCAGGGAAGTATCCACTTGAGGCCCTGCCCCTTCCAG
TGTGGCCTGGGGTCACTTCAAAAATTTGTGAAATGGCTCCTGGTAAAAAATGATTGCCGA
CCCCGGTCTAAGGCTTGGATCCTGCAATGAACTCCATGTGAGCAGATGCCTGCGCCTGTA
TGGAGCTCCATTTACTTCACTGAGACTATGCATGGACACAGGAGTCTGAGTGTTTTCATA
AAACTTATTGTAGGATTGGGACCTGAATAAATCAGATAGGGCTACAGTAAGAAAAGGAGA
GCAATGTTGGGGTTATTTTTCATACTGAGACTGAGGTACAGAGAAATTAATGGCCCGATT
TACAGAAGAGCTCAATACCTTTGAAAAATCAGGTGATCAGTCACTTGTCCAAGATAATGC
AGGAAGGGTGTAACAAGGCTAAGAACAGAGCCCAAATTTTTGCCCAGGCCTTAACTCTAA
CCCTGTCCTTTTTCTCATCATCTGTTTAACATGATACTTTAAAAATTATTTCACGTCTGT
TGCAGACAACAGGCCTTTAGTCCTGAATTTTGGAAGCTGCACCTGACCTTCATTTCTTTT
CAAATTCGATGAGTTCAACAAACTTGTTGAAGATTTTAACTCCATAGCGGATTTCCTTAT
AATCTATATTGAAGAAGCTCATGCAAAAGGTACAGTACAGACAGCAAAACATTTAAATGT
GTGATGATGCAACAGATATGGATCTTTCTGTTTGAATCATGGTTGGGGCAGGACCCAACA
GCTCTGGGACTAACATCTGGTTTATGTTTTATATTTGGCTAGATGGCCTGCTGCGCTGAG
TGAGTATGCCCATTCCAATATGCTTATTTGCAGACTAAGACAAGGGCCCCAGTCCAGAAA
AGATTTACATGTGCTCAACATTACACATGAGAATTTTCATATCTTCAACTGAAATACTTA
CATGTAACGTTTAAACATGGACCATTCAAAATTGCCTTATTCTCTTCTTTTTCTTTAAAG
CATCTGGCACTGGCCACTGTAGGATTCCTTTCCAACACTTTGCAGTTAATTTTGGATTTA
GCTATCTTGAATAATTTTGTATCATCTGGAAATTTTGTCACCTGACTGTTCATCCCTTTT
TCTAGAATATTTGTGAATATGTTGAACAACACTCGTCCCAGTAGAGATCTTTGAGGGACC
TCACACTTGTGAAAAAATGATAATTTATTCCTACCCCTCGTTTCCTGGATTTTAACCAGT
TATTGATCCATCAGAGGCTCTTCCCTCTTATCTCATGACTGCTTACTTTGCTTAAGAGCC
TTTGGAGTGTGACCTTGTTGAAGGCTTTCTGAAAGTCTAGGTAAATTATATCCACTGGCT
CACCCGTGTCAACATACTTATTGACTCTCCCAAAGAATTCTAGTAGATCGGAGAGGCATG
ATTTCCCTTTAAAAAAAAAATCCATGTTTCCTTATTTCCAATGTAGCATGTTTCCTTGTG
ATAATTCTGTCCTTTACTATTATTTCAGCCGTAGCATGTTTACTTGTGTGATAATTCTGT
CCTTTACTATTATTTCAGCCAATTTGCTTGGTATTGAAGTTAGCCTTAATGGCCTGTAAT
TGCCAGCATCACAGCTGGAACCTTTTAATAATCAGCATGACATTAGCTACTCTCTAATCA
TCTGGCATAGTTGCTGATTTAAGAAATATGTTACATACCACAATGAGTAATTCTGCAATT
TCATATTTGCATTCCTTCAGAACTCTTGGGTGAATACCATCTGGTCCTGGCAACTTTTCA
CTGTTTAATGAATTGTGTTATTTGGTTGCTCTTCAAATTCCTTCTTGGGCTGTCTAATTT
GTTTGTATAGTTAACATGCCAAAGTTTATGTTCTTTTCTATTATATTCAATAGGATTTAA
CTTCTAACTTTTAAAGGTGGCCTTTTTGCCTTTAAAACTACTTCTTTTACTCTATTATTT
AGACATGCTAGCATTTTTGGTCCTCTGATTTTTCTGCTCCAGCCCAGTTGCTTTTGTCCC
CTTTCGGAGCTGCTGGCAGCCCCATGTGGGGATCCAGTGGTGTCAGTTACTGGTTATGTT
ACCAGTGCTTTTTTTTTGTGACACTACGCACTGGTACACTCCGCACTTTCCTGTGGCACA
GCCCCCAGCCAGCTCTGGGAGCACTCACACTGTGCCAGACAGAAGCCCACTTGGGACACG
TGGCAATTAAAGGAGTCCTGACCTCCTAAATTACTCCCAGCACTTTTTTTTTTTGGCTCA
ACAAATGTTCCCCGGTGTTTTTTGGGGGTGTTTTTTGCTCAACAAATTTTTATCAATTTT
TTTTAAACCCTCTGGCAACCCTAGTACCAGCACTTTTTTTTTTAAACAAAAAAAGCACTG
TCTGTTACCTAATAAGCATCACTTGTTAAGGTTAATCTGTTACCCATTAACATACCTAAC
CTGAGCCTTGTCTAGACTAGGATGTCAGCACGTTAGTTTTTAGAAGTCCAGCATAGACAA
GGAACACTGCCTTTAACATCTATGAAAGGAAGAACTTTAGGCTTTAATTTGAGCTGTTTA
GCATATATTAATTAGAATATGTATTGCTTTGTCCACACTACAATTTTAGCTAACACCACA
CCATTTATCCATCCATGTGTCACCTTTCAATGTCTATTAAATAGATGTGGAACAGCTGAA
AATGATTTAGTCTCTAGTTTTTAATAAGCTTGCGTCTGCTACACATTTTACATTTAAAAT
ATTTCAATAGTATTTGTACCATATGAATTTAAAAAAATAAAACAGTATGCATGTGCCAGA
AATTGTTTGTATATTGATGAGAGACACACCATCAATTTTTAAAATCAGTTTAAAATTCTA
AGTAACATACCACATTTCCAGAAATCTGAAATCTGTTTCTAGAGGACCAGAAAGAGCAAT
AACAATCAGGAGTCCTATGGCACCTTTAAGACTAATGAATTTCAGCTTTTGTGGGCTGCA
GCTCGTTTCGTTGGAGCTTATGTCCCAATGCATTTGTTAGTCTTTAAGATGCCACGGGAC
TCCTCGTTTTTGCTGAATCAGACTAACACAACTGCCCCTCTGAAACTTGTCATCTATATG
TCTCAAGCTGGGTGCCAAAAAATTGAAACCTCCCAAAATGATGTGGCTAGTTATGAAAAA
TAGGGTTAAGTTACTTACTGCAAAGTGAATGGCAGAACAGTATTAGTTCCCATTCTAGTC
TCCTTTACAAAGGCCTTGATACACTGCTTTCCTGGAAGTTTAAATGGCTTGCAATTTTTT
TGGATATGCATGTCATTAACATAGCTATTGAAATTATATGGTATATAGATTGGTGTGAAT
AATATTACAGCACAGAGCTGCTAGCAATTTCTATTGGAGTTTCTCCAATACTTCCCATTA
TAAACTATTTTCTAGTTGCTCATAACTTTGTGAAACTTTTGTCCATTTGAGCTGAAATTT
TCCATGCAAGGTATCTGTCTCAAGCTGGTGGTGTTTTTTTTTTTAATTTAATAAAAACAG
TTCATCTGTTTGCAAGAACAAGGCTAGGGGAAAAATACATTTTGTTCATATTAAAAAAAA
GTAATATTTTCTTTGGACAGATTTAGTACCCCACTTTGGAGCAGGGACTTGCAATTAGGC
AACAGGTAGCTTTTGTGTCAGGAATATGCCTTTTTCCATCTCTGTGAAAAATCCCTCCAA
ATTTGATCATGTTACAAACGTTTTAAGCATATAATCATGATTTGCATATGCTTTTAGAGA
CTTCCTAGATTTTCAGCAGTTTCATTTCTGAAGATCTGTTCTAAGTGGGCATGTTCCAAC
CTGGGGCTGCTCAAGACTTTTCCTGCACATGCAGCTCTAAGCCGCTGAGAGCCATGGTGG
GTTTGGGCACATAAAGAGCATGGGATGGGTCTCCTTTGCTGTCAATGGTATATGATTATG
TGATTGAAAATTATGTCATAATGCACATGCTTAAACCTTCGGAATTAAGGTTGCACAGGC
AATCCTAATTCTGGCATTTTTTAACTTCCCAGTGCTTGACTTTGCAACCTTAATATAGTT
CTTTTAATGCAATTGTTGGTGAGTGCACACACACAATTATATATATATATATATAAAATC
ACTTTCCTCTCTCTTCTCTTTTAAAGATGGATGGGCTTTTAAAAATAACATTGTTATTAA
AAATCACCAAAGCCTTCAAGAACGAAAAAAGGCTGCACAATTTCTTTTGAAAAAGAATCC
TTTATGTCCAGTGGTTTTAGATACAATGGAAAACCTAAGTGGTTCAAAATATGCAGCTCT
GCCAGAAAGACTTTATGTGGTACAAGGAGGAAAAGTTGTCTATAAGGTAATGAACTCTGA
GCACATTACAGTATAGTTTTAACTTGTTAAAATAAGCATGTATTATCCACCACATACTAG
ATAGGTATATGATTAACATTTTTCACTGTGTTCCATTTCCAACAACTTTAAAATTAATTA
TACCCACATTGTTCATTAAATTATTAGCACCAAAAAGCCTTGGCATTTATGTATAGTTTT
GATTACCTGGCTCTGCCTCAGTATTTATGCAGTTTTTCGTAATGAGACAAAGTGAAAGCA
TATTGAGCACAGGACTGGAAGCAAAGAAATTCTACATTCTAACTCCAGCTATTTCTCCAA
CGTGTTGGTTGACCTTAACCTCTGCATAAAAGTCTACCAACTGTGAGGACAATAATAATC
AACTAGACTAAAAGAGTGTTTTGAAGTTTGAGTTATTTTTTTGTATAGCATTGAGACATA
GTGCTAATTATTATCTGATAGCCAGAGACCATGCCTGTTAAAAGAGTCTACATCTGTTTT
ATTTAGATTAACTTTCAAGTTTCAGCATTAAACTTTCCAGCAGTTAAAACTGTATTTTAC
TTTGTAATTTACTATACAGATATATATCTAAAAGTTTGTACATGACATAGGCCAGATTCT
TTACTGTTCTGTTTCTGCTTGGTGCACAAGAAAGGGTAGCCATTAGGCAATCACTTAATG
CTCCATGATTATTTAGCTGGCTCTGGTGCAGGCTGTTCTAAGCTATGCACAGGTGGCAAT
GGGTGGGTCCCAAGAGTTCATCTACTACCTGAGCAGACTTACAGTGCATCACACTGAGAC
CACTCCTCCTCCTGCAGCAGGGTCTTTGGTGGGTGGGGCAGGAAATGGCTATGCCAGCTA
TGCACCACTGGAGACTCCTCTATACAGGGAATATATCTGAACAATTCTGTATTTATTCAC
TTTACAGGGTGGAGAGGGACCTTGGAATTATCATCCACAGGACATACGTGCAATCTTGGA
AAATCTAAAATAGGTGAACAAATCAGAAACCCCCAAGGATAAAGTGGTCTATCTGGAAAG
TGATCAAGGAATAACTTGCTCTGTCCTTTTAAAAAAATATATATTTTATTGCTGTTTATT
TTTAAAATGATATAAATCAGGTTAAAAAAATACACACTCACCCAAGAGAAAATGGGTGGA
CAAGTATATAGCATGAGTTACCCTATTCAAGAAGCAGACATCAATATGATTCAACACCAT
CTGAAACTGATGGAAAAGCTCTCTAGGGCCTGGTCTACACTAACACCCCTTCCATTAATC
TAATCTACATGATTTCAGTGATGCAAATAACATAACTGAAGTCGACATACACCCCGTGGC
ATTTTCCATGCACTAAAGTTGGTGGGAGCTGCTCTCTTGTCAACTCTGGCTACTCTTATC
CTGGTAGAATACTGGAGTCAAAGGGGGAGTGCTTGAAGATTGATTTAACACGTCTAAACA
GATGTGAAAAATCAATGGCCTGTGTCTAAATTGCTGCAGTGTCAATCTACCTCATACTGG
AAACAAGCCTTAAGCCCAGATATGGGGTCACAGAGGTACCCATCAACTACAGGTCACTAC
ATTGGAAATAAAAGTAAATCCAAACAGACACGGGTGGCCGGCATGCTAAGTGGGGGAAGG
CATTGTCTTCTCAAACCACCAGCCTGGCCCTGCGCACACTTTGTCCCCAGAATGCCTACT
GTAGGTGTTCTAGGGGCAGAGTTTGCTGCCCCCAGCACCCCTCCTCCCTGTGCTCTGTGG
CTGGAGAGGCTGAGGCCACGCACCACCCACCCTCCCCATGCTCCAGGGCTGGGGAGGATG
GAGCTAAACACCGCCCGCCCACCTCTCCTCCCTGTGGTGGTGGAAGCCACGCATGCGCGG
CATGCTGCCTCATCTCCCTGTGATGGGAGGGGACAGGGAGGCAGCATGGCTTCCTTGGGA
GGCAGGGCCTCAGCAGAAGGGCTGAGAGCTTGCCTCCCCGAACCCTACCTTCACCCTGCC
CTGCTCCTTCTGAAATAGAAGTAGAAATAAAAAATAAAAGTGCAAAGATCAAAAGTGTTT
TTATAGATTCATTGCTACCCTGTTCATACACCTTTGGACCAAAATTTTTCATATAGTGAA
ATTGCTAGCCTCTAAAAATCATGGCTATTTCTCTAAATGTGTAATGGCTTTCATGTGCTC
ATCCTTAATAGTATAGGTAGCATCTGATATAAAACATATTATATATCACAGAAATAAACT
GTGTCTATATTCCTTATGCTTTGAGTAGCTCAGGATTTCTTGTAATTACTGTGAAATAGT
GAGTGGAAAGAAAAAAATATTTTATTCCACTGGAAGCACCTATCATTTGGTGCCCAGTCC
CTCAGTTCTGATGAAGGTAAAATTCCCATGAGATTAATGGGAGCTTTTTTGCCTGTTTAA
AGACTACAAGATTAATCTCTTAGGACATGTCTACATTATGCAGAAGATTAACACTGCCAC
AGTCAATCTTCTAGGGTTCGAATTAGCGGGTCTAATGAAGGCCTGCTAATTTGAACTGAG
AGGGTGCTCCCATCAGCACCGGTAGTCCTGCTCCTCACGAGGAACAAGGGAAGCCAATGG
GAGTGTTTGCTTCTGCTGACCTCCCGCTGTGTGGACAGTGTAAAAACACGATTTGAAATA
CATTGAGTCCAGCTACATACTTATATAGTTGCGTCGACCTTCCCCTTTAGTGTAGACCAG
GCCTTTGAGATTTGAAACCTATCCTTATCAGCAAAACTTTACCATTAATGCATCTTGGTA
CCAGTGGTTTTAGATCCTGTTCAATACTAGAGATAGCAATGGTACAATGTTTTATAACTA
GTCACACCAAATTTTGAAACTGAAATCTAAAAGAAATATTAGTAGTTGAAAGCTATTCAA
ATGGCTTGGATGAATGATGGAATAATTCAAAACAAATTATTGCATACCGATCCTTGTTTT
TTTAAAAAGAGACGGTTTTTCTAAATATTCACTTGCACACACTATAGCAGGTTTGTGAAT
GAAATAATTGTATTAATGTACATCATCATTGGTTCTATTAATATTTGTTTATGACAGTCA
TAGCGTAAAGCACATGCAGCTGTGACCTGATTTGAGAACATATTTA
Chart Advanced