SelenoDB
Release 2.0
Chart Advanced
Transcript Report for SPT00001900_2.0
Identity
TranscriptIodothyronine deiodinase (DIO)
SpeciesOryctolagus cuniculus (Rabbit)
Transcript IDSPT00001900
Transcript release2.0
External IDNone
Gene SPG00001805_2.0
Annotation
Prediction method(s)
(Selenoprofiles, Ensembl 68) [Report annotation error]
OrientationForward (Reverse in the original sequence)
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Full length Spliced 5UTR CDS 3UTR
Forward Reverse  
Sequence
>SPT00001900_2.0 # Transcript # Iodothyronine deiodinase  (DIO) # Rabbit 
TCGGGCAGCTGCACCTGAACCGCCGTTCATGGCGCGCATGAAGCGCCTTCCGGACGCCTG
GTCGCCAAGTACCAGCGCGACGTCGACTTCCTCATCATCTACATTGAGGAGGCGCACCCC
TCCGACGGCTGGGTCACCACTGACTCCCCCTACGTCATCCCGCAGCACCGCAGCCTGGAG
GACCGGGTCAGGGCGGCCAGGGTG
Chart Advanced