SelenoDB
Release 2.0
Chart Advanced
Transcript Report for SPT00001564_2.0
Identity
TranscriptSelenoprotein K (SELENOK)
SpeciesMus musculus (Mouse)
Transcript IDSPT00001564
Transcript release2.0
External IDNone
Gene SPG00001468_2.0
Annotation
Prediction method(s)
(Selenoprofiles, Ensembl 68) [Report annotation error]
OrientationForward
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Full length Spliced 5UTR CDS 3UTR
 
Sequence
>SPT00001564_2.0 # Transcript # Selenoprotein K (SELENOK) # Mouse 
ATGGTTTACATCTTGAATGGTCAGGTGTTGGACAGCATTAATCAGTCCCTATGGAGAGTG
TCTTTCCTAACAGACTTCTGGGGAATAGCAGAATTTGTCGTTTTCTGTTTCAAAACTCTG
CTTCGGCAAGATGTAAAGAAAAGAAGAGGCTACGGGAGCTCCTCTGATTCCAGATACGAT
GATAGAAGAGGGCCACCAGGAAACCCTCCACGAAGAATGGGTAGGATCAATCACCTTCGT
GGACCCAGCCCTCCTCCAATGGCTGGTGGATGAGGAAGG
Chart Advanced