SelenoDB
Release 2.0
Chart Advanced
Transcript Report for SPT00001060_2.0
Identity
TranscriptIodothyronine deiodinase 3a (DIO3a)
SpeciesGasterosteus aculeatus (Stickleback)
Transcript IDSPT00001060
Transcript release2.0
External IDNone
Gene SPG00000964_2.0
Annotation
Prediction method(s)
(Selenoprofiles, Ensembl 68) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Full length Spliced 5UTR CDS 3UTR
Forward Reverse  
Sequence
>SPT00001060_2.0 # Transcript # Iodothyronine deiodinase 3a (DIO3a) # Stickleback 
AAATCATTCCTTTTATCAGCTATTTTAACTGGGCCGTAATTTAATAAATTAACATCATGT
TGGATTGAAGAAGACTGAAATTAGAGATTAAGACCATAAACGCATGTTTATAATGTTCAC
TCTTGCATTGAATTAACTGAAAAGCAGTATTGTTTTTTCATTGACTTCAATACAAACGGA
CTTATTTTTGCAACCAGAGAATGTGCCCCCTGCTGGTCAGTCGACAGAATGCAAGTTAAG
TCACCTGGAAATAACTTTTTGGACAAAGAAATAAGGAAACATTTCTCAAATGAATGAAAG
AACAAATGCCCACTGTAGGATTGTTAATGTTGCAGGTTTGACTGCAGCTCCTTTGAATCC
TCTCATTGTATCTTCTTCTTCTGCAAAGACAGAATGGTGGTAAAATAATTGCCACTATCT
ATTTATTCCCAATTCCTAATAGATGTATAAGAAAATAGTAGATCGGAAAGATCATTAATA
TATTTCATTCATTTGCAGTTTTTATTTTTTAATAGTTTACCATTTGCCCGATTCTGTGTT
GAAGCGTTACAGCGTCATCGTCTTGTTGCTATCTGGTCTGTACATTTATGATATTTAACA
CGTAGGAAAATCTTTCTCCCGGGTCTCTCGTGCGTTTTCACATCGAGCACTTTGGTCAGA
ACATTTTCCACTGAAATGGATTTGACTCTGATCCAAATGCGTGAGCGCTGCGCTCCCTCG
GGCACCCGAGAGACGTTAAGCTGAAGAAACGCCCCTTCGTCTCCCTTCTCATTCTATAAG
ATTTGCATAAAGCAGCGAGGAAGACGCTGGGTGAGTTCAAACCCTTGGGAATGAGTTGGA
ATCGAAGGTGGTGATCGAACTGCCTGTCACCCGAAGCTTCGGGTGACAGGCAGTTCGATC
CACACCAAAGAAAACATTGAGATGATGGAACGTGTTCAAAGAGAATCACGCAAATGTAAA
CTTTAAATTGGACTGTCATTTACTCAATGAACAAGCCTGGTCAGTGTTTACTGAGGTAAT
GGATGAAGTCATTTTTTCATTGACTTCTACTCAATCTGTATCCTCTTTCCAACCATTAGA
ATGCCAGTTTAAGGCACTTTTCACCTTGGAGACTTGGAGGCTGAAGCCTGATCTGGAGTC
AGCTGCAGGCGCCGTGCAGACGTCTAACTAGATCTAAATCAACATCATCTGTCACTGTCA
CCGGTGCTTCTGTTGAAAATATGTGTTCATCTCAAACACTTCCATCCAAAAAAGACAAAC
CAAAAAAAAAATCTTTTCTGATTAACCGCGTCGCCCGGCACGAAACAGCTTCACACATTA
AGCGTTATTCATTCTTCTTCCTTTTCTTACATATTTCTTGGCGCGAGGTGAGTTATTGAT
CAGCTTTAGGGTCACGATACTCTGCTGTGGATCGCTCACCTGAATGGGCCTGATTATATG
AGTGAAAGAGTCAGAGGAGGCCGGTGCCAAAGATAGAAAAAAGCCAACACAAACACCGAT
GTGAGGACAGATTCTGCCTTTAAACCCATCGATCAGATGTGACGTCATCAGACGTCGGAG
TAAGTTTTGAGAGCGCGTCCTGACGAAACAATAAGCGGTAAAAAAAACACCAGTGTGATC
TTGTGTTTATTAAACACATTTGTTCAGTTACATCGTTTCAACGCGTTACATGTTTGGCAG
TCGATCACGGAGGAAAGCATCGTGCGCACGTGGACCCATCGGCGGTGTCGGAAACATCAG
TGTCGGTTTTCTGGCTTCACCTTTTAAAAACCGAACTTCACACAAACACCGGAGTGGGCC
TGAACGCACGCGCACACACGCACACCCACACACACACACGCGCGCACACCAGTATTGTAG
AAAAATAGAGTGATTACTGATCGGATCCAGTTTCACCTGATTCAAGACCTTTCCATTAAA
AAAAACAACAATAAAACAATCGATTAAGGTGAAGACAAGCAACAACACACCTGCCCACAT
TTATGCTGGAACACCACTTTAAGCTATTTGTCAAAGAGTCCTGAATATCTTTTACGCGAG
CGGAACAACATCGCGCACCACGTGCGCACATTTGATAGCAGCATCGGAACATTCCGCCCC
GTCAGTTTGGACACTTGCGCGCGGCGGCCCGCGCAGCATCTCCCGCTACACGTGGAGCAC
CGCTGTTTGGGAACGCGCCAGCTCGCTCCTGTATTCGTCCAGCCAGGCGCGAAGCTCGGA
AATCCGGTATCCCTCGGGCCCTCGGCCCCCCTGGTACACCACCCTCTCGTCCCGCACGAC
GTAAAGCCTCTCGAAGTAGGCTCCGTACGCGGCGCTGGACGAGTTGTCCATATTATCCAC
CACCACGTCGCTGCCGGGCACCTCGGCGAGCATCAGCCGCGCGGCTCGGAGTCTGTCCTC
CAGGCAGCGGTGCTTGGGGATCTGGTACGGCGCGTCCGAGCTCACCCAGCCGTCCGACGG
ATGCGCCTCCTCGATATATACAAGTAAAAAGTCCGCAATGTCCGCGTACTGGCTCACGAC
GCGCTGGAAAGCCGCGAGACGCGTCATGAAAGGCGGTCAGGAGCAGCTGCCGAAGTTAAG
GATGAGCGGCCGCTTCCCTTTCGTGCAGTCCAGGATCGGGACCCGCCGCCGCTGCTGGAC
CAGCATCACCTCGGTGTTGGGCGCCGCGCGCCCGAGGTGCGCGGCTTTGAGGCAGTCCAA
TTTCTGTCCGTACCACACGGCCCTGAGGGACTCCAAGGTGAACATCCTGTTGGAGTCGGA
GACGCACAGCGGCGGGTCGTCGGGGCTGTCCTGCCGCTCGCCCATTTTCAGCAGCACTTT
CCTGATACACAAGAAATCCAGGAGCCACAGCATGACGGCGGCCAGGAGGAACCGGGGCAG
CAGCATCAGGCACAGCGCGGCGTGCTTCAGCGCCCTCGCCGTCCGGACGCCGCCGCCGGA
GTCGTGCAT
Chart Advanced