SelenoDB
Release 2.0
Chart Advanced
Transcript Report for SPT00001041_2.0
Identity
TranscriptSelenoprotein N (SELENON)
SpeciesGallus gallus (Chicken)
Transcript IDSPT00001041
Transcript release2.0
External IDNone
Gene SPG00000945_2.0
Annotation
Prediction method(s)
(Selenoprofiles, Ensembl 68) [Report annotation error]
OrientationForward (Reverse in the original sequence)
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Full length Spliced 5UTR CDS 3UTR
Forward Reverse  
Sequence
>SPT00001041_2.0 # Transcript # Selenoprotein N (SELENON) # Chicken 
ATGGCGGTTCCCGGCGCGGCTCCGTCGCGGCTGGCGCTGGCCTTGGCCGCCTTGGCAGCG
CTGGCCGCCGTTAAGTACTACCGAGACGCCGAGGCCGCCCGGCAGCAGGTAGCGGGACGG
CGGGGAGGGCCCTCCGGAAATGGCGGGCGGAGCGTCTCCGCTGTGGGGCTGAGGGGGCGG
CGAGCGTGGCGGGGCTGCGGGGCCGTGCGGCTTCGTTTGCTGCCCTGCAGCTGTGGTGGG
CGCTGAAGTGAAGTAGGCTGAGGTTGTACTGGAGTGAGGGAACCGCGGGGCTGAAGGGTC
TGCCACGGGGATGAGGTGGCCGGTGCGGGGCTGAGGGGTCCATTGTGGGGCTGAGGCGGT
TATCACGGAGCTGAGGGGTCTGTCACTGCCCCTCAGTTCAGGAAGGGCAGGGAACTGCTT
GAGAGAGTCCAGCGCAGAGCCACCGAGACGCTGAAGGGAGTGGAACATCTCCCTTAGGAG
GAAAGGCTGAGGGAGACGGGGATCTTTAGCATGGAGGAGGCTGAGGGGTCACCTCATTAG
TGCTTATGAATATGTAAAGGGTGTCAGGAGGATGGAGCCAGGCTCTTCTCAGTGGCGTCC
AGTGATGGGGCAAGGGCTGCAAGCTGGAACATAGGAGGTTCCACGTAAATATGAGAAAAA
AACTTTGTCACAGTAAGGGCACAGCAGAACAGGATGCCCAGAGATGTTGTGCGGTCTCCT
TCTCTGGAGACATTCAGAACCCACCTGGGTGCACTGCTGCGTGACCTGATCTGGGTGCTC
CTGCTCTCACAGGGATGATCTTTCAAGGTCCCTTCCAATCCCTGACATGCTGTGATCACA
GTGCTGAGGCGTCCATGGTGGGGCTGAGGTGGCCACTGGGGTAGAGATGGTCACCAGGGT
GATGGCGGTGGTTGCCATGCTGAGGTGATTCCAGACGTGCTGTTGGCTCCCAGTGGGCTG
TGGAGGCAACCGGGGATTGGTGGCCACAGAATCAGTTTTGTGGCAGGTTGTGACTGTGGG
CAGTGCTGGAGATGAAGAAAAAATGTGAGCAGAACAAAGGTCTTAACTTTTCTTCAGCTT
GCTTCAAGCACGTAGTTCTGGTTATTGGAGCACGCTCTGCATTCTTATGGGCTGATAGAT
GGTAACCTCTAACACCTGGCACCCACGTGCCCTTCTTCATATTCTGCTGCCTTCGCTGCT
CAGAAATGTTCTGCATGTGTGGGACATAACTGATTCTCTTTCTGCCTCCAGCCCTGTTAA
GCAAATTATCATGTCGTTTTCCTAATGCTACAGCAGCAGGTGGTCTCACCAGCTGAAATC
TTCGTTGCTCATTTGCCTTCCATCCCTTGAGGTCCGTCTCTGTGAAGTGCAAAAGAAGAG
GGAGGCTCTGAAAGATTCATCAGCAGGGAATCATCGACGGGCCTAGGACGTGGCTCATCT
CGTTATAGAGCTTAGCACACAGCCAGGATGGCCTCCTGTGCAGAGGAGGTTGTGCACAGC
CTACACACTTGGCTGTGCTGTAAGGATAGTGCAGGATGTGCCATGCCCAAGCAAGCTCTG
GAGCCTGGTGCAGCACTTCATGACGTGACCCTGTCACCTGGCTCTCAGCTAACGGGGCAG
GAAGGTGTTACGTAGAGCCCCATGTATGTTTGTCCCCATTCACCTAGGGAATAAAGGCAA
GGTTTTGGCCCGAGAAACGTGGAGAGTCCTGAATGGGTTGCTCCTGTCTGTAGATAAATA
ACCCTCATGTTCCTTTACTCCTATTTGCAGCTGTGTAGTTCCTGTGTACTCTTCTCCGCG
TTCCATGTTCTGTATTACTGCCTTTATTCAGTCATGTCTGAGTCCAGATCCTTGGTTTGT
ATTCCAGTGTCTTTATTTTTGCCTGCTCTATCCTAAAACCACCCTGGAGGCTCTTAAGTG
CTGCTGTTGCTGCAGATGGTGGGAGCACAGCCTTCTGGGCTGCACTACTGCTGCTTCAGA
CTGGCAGGCAACAGACAGGAAAATAAACTCGTTCAGGAGCTGTGGGGATGATAATGGTGC
AGCAAACAATAAACAGTTGAACAGCAGATGACAGTATTTGTCCTTTAGGTGTTTACTGGG
GTGGCAGGGGAAGCTGCCCCAAAAGGATAGACCAGATGGACCTGCTGGCTGTGAGTGATG
TGACTTGTCTGGCTTGCTGTCCCTTCCCCTCACAACGATGTGGAGCTCTCTTGCTCTGCC
TGCAAGTTGTCCTTTTTCTGTCAGTGCTGAGTGCTGCAGAGTGGAAATGACTAGAAGAAC
TTAGTCTTTCTGGGACCGTTCCAAGTGAGACTTTGCATTTCAAGGTGTGTTATTGCTGTT
TGCCATTGGAGGATCTCCACGTGGGCTTTGCAGGCCGTCCCACCAAAGGTTACGGAGGGA
GAAACTGAGGCACGGGGATCTTACAGGAGGGTCTGGAGAAGGTGGTTTGGGTTGTGGTTC
CTGATGTACGGGTAGGTAGTGGTCCCTGTGGAGCAAGGAGCCAAAATCTTGGCCTAGTCC
CGACACAGCAGACAAAATCCTGCCAAGGGATGTTAATCTTTCCATGTGATCACTGTTTGT
GGTCTGGAAAGAATGCGAATTAACTCCGAAGCTGAGAGTGCTCAGGATGAGTTTCTGGGA
GAGGTAGGAGTGAAACCTCGCTTCCCCTTTCTTCCCCACGTAGGAGCTGGCGCTGAAGTC
TTTGGGCAGCGAGGGGCTGTTTCTCTTTTCTTCTCTGGACACAAACAACGATCTGTACCT
CAGTCCAGAGGAGTTCAAGCCAATAGCTGAGAAGCTGACAGGTACGTTTCTGTCTGCCAC
GCAGAGCTCCCTCTGCACAGACTGAGCAGAAGCCATTTTTATTGACGTCTTTATTTTTCT
TCTGGGTGCTGTTTTGGGTCATGCTTACCTGAAGAGAGACTGCTCATGAAAAGGCTTAAA
CGTTAGGTGCCACTTTTGCAAAGTTCAGTTTTTATGAGACTAAAGGTCCCATTTCTGGCC
TAGCAGAGCATGTAAGTTACTTTGTCTAGAGCTTATAGGAGATTTGGGATGGATAAATGC
AACAAATACGGCTCAGCCCAGGCTAGGCCAACGCCGTTAGTGAATCCCATTTCAATCAGA
TGCTTCTCATGCTGCAGCGTTCTCTCTCATAGCAGCTGTGAGAGGCCATGTTTGGAGGCT
GTATCAACACGTAGCAAATGTCTCTTGGTGGTGCCAAGCAGAGGGAAAGAAACGTGGTGA
TGATAACATCCAGCAGAACTTAACAGTGCAATTGAAATACAGAGAGTTGTTTGCTTATGT
TTAATGAATTGACTGAAGCACTTGTCTTTTCCCTCCTAGATTAGATGAGAGTGTTTAACA
GCCATGGAATTTAGAGTGTCATCCACTGAAGGAAGGGCTCCCCTTTAATTCATGTGGCAA
AAGCCAGGGGTGGCTGCTAGCTCTGGTGGGTTCCCCATTGCACACAGTGTAGTGACAGCT
GGGAAGCTCTCAGTGCTCCTAGGTTAGCCAGGAAAAATGTATAATCACTTCACCATGGTT
TAAGAGGGGAGGGAGAGGAAACAGCTGCTTAAATTCCTGTCTCCTTGTTTAGGAGTTACT
CCGGTCTCGGACTTTGAAGAGGATGCACCTGATCCAAATGGGGAGACGTTGTCCATTGTG
GCTAAATTCCAGCCTTTGGTCATGGAAACGATGACAAAGAGCAAAGATGGTTTCTTGGGA
GTATGTATCCTGCAGGATGTGTAGGGCCAGAAACACCACTATCACCATATCCTATGGGCT
GGTAGCATCACCAGGAATGAGCACAGGCAAGGCCTCTCTACCCTTGAGACAGTCAGCAGC
TTCTCCCAGTTTAGTGTCACCCGCAGACTCATGCAGTATAGCTTCAAGTGCTGCACCCAA
GTCATTGATTAAAACACTGAAGAGAACTGGCCCTAAAGTGGAGCCCTGTGGAACTCTGCC
AGTGATTGGCCACCAGCCCGATGTGACCCCATTTCCTATACCCCTTTGTCAGCCAGTTGT
TCATCCATCACATTGTTTTTGTCTAGCTGTATGCTTTGACCAGTAAGCTAGCAGCTTTCT
GCACTGTTGTATTGTTTTCAGTGCATTCAGCCCCGCTGTGTCCCAATGAATGAATGCTGT
GCTCTTCCTGGGAAGTTTGAAGCAGACACCAGAGGTGGCTCCACCACAGGCATTGTTGTG
TCCCATTCACCGCCTCCCATTTTGCTCACATTATGGAAAGCTGGCAGAACTATTTGGTCG
TGTTTGGGGTGGTGCAAAGAATTGAAAATATGATATTTTTTTTCCTTTCTCCTCCTGAGC
ACAGTTACATCCGTCAGCATGGCTGTGTGTGTGAGGGCTGTAGGCCAGGCTCTGATGCTA
TCTTTTGACAGATCTCTCACGTTGCTCTTTCTGGGCTGAGGAATTGGACTGCTCCTGTAT
CCCCTAAGAGTGTGATGCTTGCCAGGCAGTTTAAAGCCTTTCTTCCTCCGAAGAATAAAC
TTGATCTGGGTGATCCGTGGTGGATAATTCCTAGTGAACTGAACATCTTCACTGGATATC
TTTCCAACAACAGGTTTTACCCTCCACCTCCCAAAGGCAAAGAGGTGAGATACGAGATTT
GATTCCCATATATCTGAGAGGTGGCTTGTATGAATGTGTACTGCCTTATAGCCCAGATAA
ATTGAGTGGACAAGGCTGTTGCATTATGTCTCCTTGGACTTTCCAAGGCAGCAAAAAGGC
TGCAGTGTACAGCCAGGAGCACTATCTTCTAAATCAGAAGTAAAAACTGAAAGCAAGCAA
CATCTCAGGGTATCTGCCATTTGTAAGGCTGACTGGAGGAGCTTCATTTTGCTTTAAGTG
TTTGAGTTCTTAGTTTAGTTGTGAAACCAGTGTGGATATCGCCCTCCCCTGGGTGCCCAA
ATAGGTGTCCCTGATCACATAGCTGATACACCTTCACAGTCTGTGTTTATTGATTGCATA
CTCACCCTTAAGGAGTACTGATTAGATACGGCTTTGTGGATCAGTTTAGCAAGCTCCTTC
ACCCGATGTGGATAAATGGAAACTTGTGAACAACAGCAGTAGCATAAAAAAATATGGAAG
ATGGATTTATTTTTAAAGAAAGCCTCTAGCTTTGTCTCCTTATTTTGTGGCTAGGTGGGG
CTCCAAGCTAATTTTTAAGTCACAGCAAGTCTCCTGTCTTCCTGATCTGATGGGGAGTTG
TTCTGGAGCTGCATCTGACCTGTTGTCTGCGCTAGGCAAAGTGCTGTCATTCTTACTCTT
ACAATTCTTGCCATAGATCATAATCCACAGGCTTCTGAGCATGTTCCACCCGCGCCCCTT
CGTCAAAACCCGCTTTGCTCCCCAAGGATCCGTGGCCTGTATCCAAGCCATCAGCACCTA
CTACTATACCATAGCGTTCAGGTAAGGGCATGGGGCCATTCTGTTAGAGAAGGGGACACT
TCTGTTTTGTACCATATCGCAGGGGAGTGGAGAAGGCTGCAGTGTGTCAGTGCCAGAGGG
CATGTGTGTTGCTTTGTATGCAGTCCTGTTCCCAGACTAGATGAGATGTGCCCTGGCTGG
AGCTGGATGAGAGCAGCTCACAGCCAGCTCTTGCTGTGAGTGATGCTTTCCTGATGCCTG
AAGGGGGCACCTGTGCTCCCAGGGTCACAGCATCCCTGGTGTTGCCCAGGACAGCAGCCA
GTACGCTGTCACACTTAGCAATGTCTGGTTGAAAGGAGAGAGTCTGAATTGCAAAGAAAT
TGTTAGATCTTGTTTAATCAGGGGATAGAGTGTTTCTCCAAGGGAAGGGAGGATTCTGTG
GAATTGTTCTCATGTTTTACTGTCTTTGTTAAATACAACTGTTATTTGCCCAATTAGACT
GGAAGGGAGACTGAGGGTATCTGAGTTTGTTTCTGTGTTTCAAGGGCTCATAATGTAATT
CATCCTTCCTGGTGTACCCTTACTGCCCACTTCCAAAAGGCATCAATACCAGCGACACTG
CTGACCCTGGGAATCTGCTCCAGTCTTTTACCTTTCTTGTTGGACGACATGAAAAGCTTT
TTGAACCAAACCCCTCTCCTGCAGTTGTACTTTCTGGTGCCTGCAGATCGCTTCTCTCTG
CTGTCATTTGCAGTGCACGATCCCTTCCTCCTAGCTCTGGAGCTGATGGCTCCCATCTCG
TTTCAGGATCCATGCTGAGTTCCAGCTGAATGAGCCACCAGACTTCCCCTTCTGGTTTTC
CCCAGGCCAGTTTACGGGTTACATCGTCCTCTCCAAGGATTCTTCCCATGTGCGAGAGTT
CAAGCTCTTCGTCCCTAACAAGAGGTACGGCTTTTTCTTCTGTGTGCTGAACAGGCTTGG
GGATTGTGGTAAATGAAGCCCAGTGGAACTCAGGGACTCTGGGATTCTGTCCTGTACAGA
GCAAAGGTGGAGACTGTGCATAGAAGGAGGCTGGTGGATTCTTTTTATTTGAAAATACGG
GTGCAGTGACAACCCTGAGCAGAGCACTGCAGTACATGGTTGTCCTGGCCTGTACAGGAA
AGACAGATCTGCAGTCTGAGCTTTGTGCCTGCTGGTTTTGCTGTTTGCTTCTGTTTTGTT
TGCACATCCTTCTCTGCTAGTGTTCATTGTGGTTGTCATGTTTTCTGTAGATAGAACTGT
TCCCTAATCTGGATCTGATGCAGTTTTTTCAAGAATACTTCTGCTTATCAACAGGTGTGA
GGGAGGAACATCAAGCTTTGGGAGAGGCAGGGAAGGACAAGGACTGAGGAGGGAGAGAGG
GACAAGCTGGGCAGAGATTACAGGAGACACGGGGCATGAATGGGACTAGGGGATGGATGT
CTTTGCATAACCTGACTGTAATGAGAATCCAAGTCTGAGCTGTACTGTGCCACACCACCT
CAGGAGGGAGGTACCTGCAGCCACATGGGGAGACACAAGGGAAAGGTGAGTTTAAGTTTT
CCTGATATTGCCCTAGAGACAGACAGCAGCCTCTTCATTATCAGCACAGCTGGCTGTGAT
CCTCTGACCCGTCCCTACAGCCCCTGCGTGTGGCCAGGACACTTGGAGAAGTCAAATGCT
TGTTGCAAGCTGCAAAGGCTTCTTGGTTGTCAGCTGGATGAGCTGATGCTTTTCAGCCAA
CTCCTTGGAAAATCTGAGTGAAATGAGCTTTACAGTTGCCTGCAATACTGGCAAATGCAT
CTCTGCAGTTACTGAGAATCCCTGAGTTATTTTAGGGTCTGATTCATTCACCAGGAACTG
TATCTCTTTGTACTTGGAGCATGAGGGGAGATGGAAAGGGTCTGAAGAGGCAGCAGCCCC
TGATGATCTCAGTGCCTGGCTGAAGGCACTGAAGTTCAGCAGAGTCTGATGCACGCACTT
CAGAACATTTCTGCTTGTCATTTCGTTTTATGGTGTAGTTTCACACTGGCTTATTCCTGC
TCTCTGGCAAGCAGCTGGAAGTGTTTGAGGGGAAAGGAGCCTCAATTCTCTTTGCCTGTG
ATGACAGGAGAGAAAATTACATTTTAAAATCCTGGTGACTCTGTCCTTATGGCTCTGTCA
GCACATTCAGTAGAGCAAGCAGACACTTCCAGCTCTGCCAGAGCTCCTTACAAAAAGCCT
TTTGCTTCCAAAAAAAAAAAAAAAAAAAAAAAACCAACCACTTTTAAAAGTTCAGAGGGA
TCAGAACATGCAAGTTAAGTGCTGGCAGGGAAAGATGTGCAAATACACCTCTCTCTTCTT
TACTTCGATGCTACTCAAATGTATGAATGCATTTGCCTGAAATGTTGGGTGGGTGTTTGG
GCCCTGAGCCAGCAGGGATCTACTGTTGCTGATCTTGTGCAGGGAACACTGTGATCTCTA
AGAACCTAGAGGTTCTGAGCCTCAGTGTGGTCCACTGAAGAAGAGCATTAGGATTTTCCA
TGCACAGCTTTAGCCTTGGGTGGCTGAACATTCTGGGTTCACCTTGCAGGTCTCTGAATG
TTGATATGGAGTGGCTGTATGGGGCGAGTGAAGGCAGCAACATGGAGGTGGATATAGGTT
ACCTGCCTCAGGTCTGTATCCACACTCAGTCCTCTGTGTGCATGCTGTATCTTGGCAAGG
ATTTATGCTGCCTTGTGCCTGAGCTGCATAACCTCAGTTGTCCTTGCTAGTTAGAGCTTT
CTGTTGGATGCTTCAATATAATAATATAATCTCAGTTGATCTGTATATGTCCTTTGCAGC
GCCATGACTATTTGCAGCTCTTATGATCTTTTTACTCCCCTCTGTTGGTCTCTGTGGGTT
GAATCTTAACCTCCTGGAGTCACATGAATTTTTCTATTTTTAAAAAGTTGACTGACAGGC
AGAAGGGATGAGGGAGCTGAATGCAGGCTCTGAGCCCAGAGGGCTGTATGTACAACAGCG
TGTCTGGATTTAGAAACTGCATGAGCTTATTCCTCTATTTTGTGGTAATCCCAGCTCTTG
GGACAGGAAACATGAGTCAGATTCTAAATACCTGAATTTAACAGTCCCATTTTCTCCTGA
ACTAATGTTTTTAATCAGCAAAATTAGTAAAAACAGACTTAAAAAATAGTTTCCACTGTA
CCAGGAGGCTGAGCTACAGGGGAGCTCCTGAACAGCTTTCTTTGTTGCACCTTCTTGTGG
CTATAGGCACAGACTGTATAAGGGCTTTGCTGATCATGTGAACAAGATTAGCTCTGCAGA
CTGTAATCATTTTGAGGGTCTGATATCCCACAGTCAATAATCTCCACTCCGAAGATAGCA
GCACATAATGAACAAGTTTCATGCATTTCCAATCTAGATAGCACAGGCAGACAATAACTG
AAGGAAATGAATTTGCTTTCCTGTTATTCCCCAATAAAACAGATCTACAGTTGTTCAGGT
GCAGCTCCAGGAGAAATATCTTCATTAGAAGCTGTACAGTCTTAATTTGCATCTTTATCC
TATCCTGGTGTACAGAAGAACCCATAGCTGAATATCTACAATGTCTGACTCTGAGCTTCT
TCTCCTGTAGATGGAGCTGGAATCCACAGGGCCCTCGGTCCCCTCTGTGATATATGATGA
GAACGGAAATGTGATTGACAGCAGGGATCCCTCAGGGGAGCCTATTCAGTTTGTGTTTGA
AGAGATAACCTGGCAGCAGGAAATCCCCTGGGAAGAGGCAGCCCAGAAGCTGGAAGTGGC
CATGTATCCATTTAAGAAGGTGAGGAACAGGCTGTACTTTTCATTGGCATATTTCACTGT
GACAGGTGATTTTTACTGAGGTGTCCAGTCACTTTGAGAACCAGCAGAAACCAGAGGCCA
CAACCTGATCAGCACTCAGAGTGGTTTGAGGGTCTCCCAGCTCAGTGTGTGTTCCCTATG
CTGCTGTGTCCTAACCACAGACTTATAGCATTGGGTTATATATAGAAACTATTGAATATG
ACAATAGTCTCTGGAACAGATGGCAGCTGCATGTCACTCCTTCCTTGGCTAAGGAATGTT
CCAATGGCTATCTCCTTGTGCTTGAGCTTGCAAATCTCACTTTCACCTGCTCAGGTGATA
ATAAAGTTCCCTTCATTCGAGTGATGAGAACATTCTCTGTGCAGGGTCTTTCTCAGACAT
TTTTTAAGCTGTTTCAGTGACATTTTGTGATAAATATCTCAAGTTCAGGTTTCCCAGCCT
GCAGAGGCACATTTGCAGGTTGTCTGCAGTGTGTAAAGTTGGGTGTGCAAATAAAAACCC
ACATGCTATGAGGGGTTTGTTACAATCTCACTGCATCCTCAGCTGTTTGTCAGACTTGAG
GGTAATTTTATCTTCCTGAATGTTTCCTAAAGGAGTGGCTATGGGTCACGTGGTAACACA
GTTAATGCTTCAGACTTGGTGTGCCTTGCTGCATTCTACCTGAGCAGCAGTAGCAAGATG
ACCAGCTGAAAGTCAGCAGGAAAAGAGATTGTTCTTGCCAATGAAGTGCCTCCTTACTTT
ATGTAGTCTCTGTAGTGAGGGAAGATAAAAGCCCTCCCCTGGGGAGAGCACCACAGTTAG
CATTTGCTTTGATCTACAGAAACTACTGTGGGTTGTTGTATGTCACCTCTGGGGTGTTCC
AGATTTGGTTCATTCAGATCCCATTTGTATTTGGGATGGGCTGTTCTGTGTCTGCTTCTC
AAGTCTCCTATCTGTCTCCAGGTCTCCTATCTTCCCTTCACAGAAGCTTTTGAGAGAGCA
AAAGCAGAAAAGAAACTGGTGCACTCGATCCTGCTGTGGGGTGCCCTGGATGACCAGTCC
TGCTGAGGTGAGGGACTCTTCCACAGCAGCTGGAAGAATGATGTACCTCATTCTGGGTCT
AAGAAGGGTTAAGTGTCAGGGATTTTGTGGCAAATGCTTTGTTAATCGTTTTGATACTGA
AAATGCCTGAATAGAAAATGGCTGGAAGTGGGGAATTACTGATCAGAGCTTAGATACCAG
TGGTGAGATTAGATCTGTTAGCGAAAAGCCCTAGGTGACTCAGTAATTCAGATGCCTCTG
TTGAGGGGGAGCTGTGGATCTGGTCTTCCCTCTTTCTCTTCCCTTCTCAGTCTGCTAAGG
TAGAGTACAAGAGACACTGCTGTCTGCTTTGTCCCTCACACCTGCTCAGGAGAAGCCAGA
GCCAGGCATAGGCCTGGAATTGTCGTGCTGTGTGACTATTTCTCCATGTGCCCAGTAACT
TGCATGCTACATTAGATAGGAGTAATATTTGGGAGAGGTGTGATTATCTTTGTCCTGTCT
GCCTTTAAAAACTCGCTGAGCAGATTCCTCTGCTTAGTATGAAAAGCAAGAGGCACTCAG
GGTGAGTGTGCAGGGTCTGATCTTTTCTGGAAAGCACCAAACCAGTCAGCCCCCATGACG
TTCTCGCCCTGGTCCTTGTGCTGTTTTGCAGGTGGGTGGGGTCTGCTCTGGTGAGTCTTC
TTTACCAGCAGCATACACTGGAAGCAGTAAGCTATGGAAAACTGTCAGCAGAGGGGAGAT
AAGACCATGTGCCAGGTTAGGGGGAGCCTAAGCCAGCTGCTGCAGCAACTCAGCAGTGGC
ATGAATCATGGCAATAATCAGTCACTGCAAACTACTGTCTGCTTCTCTTTGTGTGCCAGG
TTCAGGGCGAACTCTCCGGGAGACTGTCCTGGAAAGTTCGCCCATCCTCGCCCTGCTGAA
TGAGAGTTTCATTAGCAGCTGGTCACTTGTAAAGGAGCTGGAAGAGCTGCAGGTGAGTGT
CACAGCCCCTTCTGCTTTCTTTGTGTTTGGTGCTGGTGAACACAGGTGGTGTTTGACACA
GGGGTGCTGGCAGAAGAGGGGAGATCACACCTGTGCAGATGAGACATTTTGGTTCCAAGC
CCTGTGTGTTCTGGTAACCACGGTGGGAAAACAGACACCAGATAGATGCTGGCTAAGAAA
ATAGCACAGTCATCCCCTTCACTCTGTTGTGGTGCTGGTACAAAAAACCAGACCAGATGT
TTCACTGCTCCCAGATGCTTCAAGCCCTGTCCAAGGCTTGTTGTGCTATTGGCAGGCTGA
CTTCTCTGTAACTGAGGGAGTAACCAAATACTCTCTGACTCCTGGGTCTCCTGACTGCAC
CTTTCCTCACTCATGAGTTTACCCCTCGGCCTTTGCTGTCGGCAGGGGTCAGTTACAGAG
CTGGAGATGCTGGGAAAAACTGGGGTTGGACTGTTCCATGTGCATGGGAACTGCCAATAA
TGGGATGATTTTATTTTTGGAGGAGAAAAGCTGCAGCAGAAGTGTGAGGGGTGGGGGATG
CTGGCAAGGGAATAGTAAAGCAGATCATGAAAATGGAGGCAGCTACCATGGTACAGAGTG
GCTCTCATATTAGGTTTACTCCTCCTGCTCTCTTCTGCTAGTTTTGGTGTATACAAATGT
GTTTCTTTGGGGTTCCCTTACAGACAAACAGGGAGAATGAGTTCTACAGCAAGCTGGCTG
ACCTGCACCTTGAAAAATACAACTTCCCTGTGGAGATGATCATCTGCCTCCCCAATGGCA
CGGTGGTAAGATCATTACCTCTTCAATTTTACTTGGTTCTCCCCGCCAGAATGTACTCTC
ATCTGCAGAGTCTGAAGTGAATGTCACGCTCCCTCAGCCATTCTCTGGCTCCTCAGTCCT
TTGCAGAACTGTGCGTTGTTCTCATGGATGCTGTGACAGACAGCAGGAAGTGCTCTACCA
AGAAATCTGAAACCAGTGTCTTTTTATTCAGAGACAGAATAGCAGAGCGTCTAGGGGGAA
AAAACCACAATTGTACCAAACGTCTACCTGTGTTTTCTCATCCATGGTTGGAGCTAGTGA
CATTTAGTATGCCACTATTGCTTTTTTTCCTGCACCCACTGACCTCTGTGTTCATGCTTT
AAGGAGAAAATCTCTCCTTAGCAGCAGCTTCTGGCACATTTATCTTTTTCCTTGCTGTGC
GCCCCAATGACCACCTTTGCCTTGTATTTCAACAATAGCTCCTTGATGCTTCTTGCCATG
GGGTTTTGCTGTGTGTCAGCAGTGGAGGATCTTGCCATTGCTAATCTGATTGTCCCCCAC
ACTAGCCAGACCTTAGCTAGCAATATCTGCAGTGACTTCTTGCTGTCTCTTTAGTGGCTC
CTCTCCACACGAGGCTGCAGGCTGGTGAGAGGCTGCAACTCAATGAGTAACAGCCTGTTA
AGTTTGCTGTGAACAGTGATGGTTTGGGCCCCTGTCCTACTTCCTGTGGGGAATGGAAGG
CACAGAGGCATTTTAAACACGTGCTGGTTTTGCAGGTCTGCTGGTCTGAGAGCTTGCACC
CCAGCAGTCAGCATGGCTGGGCTGCCATGTGCTGACCTGCACTCATAGCTAAGTTTTACA
GCTGCATGATTTCCTCTCAAATCACCTTCATATTTTTCTTAACCTAAATGAGGGGTCAGC
ACTGTCAAGGGAAAGAATGGACCATTGTCTTTTGGTCATCTTTGTCTGACTGTGAAATAG
AAACCCGAATCCTAGGTGCTGAATTAGCATTTGCAAAGTATTTGAGATTCTTCAAGAGTT
GTTGCAGTCTTGTCACCTGTGCCATGGCTAGAGGCCAAGGCAGTAGATGGGACATTGTGC
TGGCCTTTAAAGTCTTCTCATCTGTTTTCTCTCCTAGATTCACCATATCAATGCCAACTA
CTTCCTGGATATTACTTCTATGAAGCCTGAAGATGTTGAAAGTAGTATCTTTAGTTTCTC
AGCCAATTTTGATGACCCTTCTACTGCAACTTACCTCCAGTTTCTGAAGGAAGGACTGCA
AAGAGCAAAAGCTTACTTGCAGAACTAAAACCAAAGGCACCCAAATGCCTCATGGAGTTG
GCCAAACACTTCAGACGTCTATTTTGATTGCAGCAGTTCTTTCTCATCTTCATGCCATGC
ACTGATGTTAAGATGCAGACAATTCCAGGACTGGGGCTTTTCTGTGGATGATCTGGAGAT
GTTGGTTCAAGGCTAAACTTTCAAGTGATACCAGTTTATGTCATCTGCCCATTCGAGTTC
AGGCAAGTTTTTACAGGAGTGAAAATACTTGGATCTATAAACATTCTTTGTGCATACACC
TTGCCACCCACCCTCATATTCTTCCACCTCTTGTTCAGACTCTGGGATGAAACTCTCTTT
TACAGCCATACCAAGCATCGCCAGGAAACATCTGATCTCAAGGGCTGGACTGTGTGTTGA
GTTACAGAGAACAGCACTGCTGTGATGACCGAACACTCGTGATGCACACCTGTGCTGTGT
GGGCAAATGCACAGAATCCAGTGTGGACAGCAAGCTCTTCCCTGGGCAGCTGGTGGGCAC
TGTGCTTCCTGCCAGCAGCACTGAGCTGTAAGCTGCTCTGTGGCGTGGATCCCAGTTCTT
TGTGATAGCATTATTGACAGCAGTGGCAACCTGTGTGTAATAGGATTGTAGCTGATAATG
TGTAGGCATGGAAGTAGGAAGATCTAGCTGCAGGCTTGATCTCTGAAGTAGCCTCCTCCC
AGCTTCCTGGATGCCTGGGACAGTGATCCTGAGTGATGTGGTGCAAGAGCTGTATCAGTC
ACAATGTTTGCAGCTGATGGAGATGGTGGGGTTGATGTGGTGCAATTGGGAGCGGAGAAT
GGGGCATTATGGTGCAGCTTAGAGATGTTAGGTATGGATTAACTTGGGGGGATTAAGGGC
CAAGGCTCTGGCAGTGAGCTCCACCTGTTGTAGGGTGTGCCTACAGGCTATGGGACACTG
TAATGAGCTGTGCCCCCATCCTATTTAGACCAAAGCTACTCCCACCCCACCTGTTTTGAG
AGCTTTGTTCTCCCAGTGTTTCATCAGTGGTGACAAAATACTCAGTGCATGTTTGATGTG
ATTTTTCCAAGTCATACTGAATAATGGACCGTGATTAAGTCCCCTTTAGGAAGAGGAGAT
TCAGCCTTATCCTGAGAGCACTGAGTGGTTTAGAATGGACCAGTTTTAAAGAAACTGTCA
GGAGCCTTTCCCAAGGAAGGAACTGTTTGACCAGAGTGCCAATTGCTCTTACCTGTAAAC
ATCCTGAGCAGTTGTTCCTCCTCTGTACCAATGGCTGACTGCACAGTGAGTGAAATTTGG
GGAAGGGAGGGTAAATGAAATGGTGTTTTAAGCACATTCCTATAGATAGGTGAGACAAAG
CATCTTCAAAAGATGGCTGCAAGCAGCTTTCTATTGATGCTTTTTCTGCTCTCTGAAGCA
CAATTTTGTTGAACCAAATCCAAAGTTGGGGGAAAGCCTCTTTTTTTTCTGAAGGGGGGG
GGACTTTTATTCTGGACATCAGGACCTGGAAGGGATGCTTGGGGTCATGATTCACAGAAC
CACAGAATGGATAAGGTTGGAAGGGATCTCTGGAGCTCATCAGGCTGAGTTCAGATGGAT
CTTTGAGCGACTCAGTGTAGCTTTGCTAATTGCTCTAAGTGAGATTAATTACCTGTGGGA
TGTTTCTTAGTACTGGCTTTTTAACTATGCATTAGCTCTGCACTTTACTAGCCCTTCAAG
TGGCCTGCAGTAATTACAGGCTTGGATTACATACAGGCTGTGCTTTCAGTGGTGGCCGTG
GAAAGTGTCAAAGCCTCCAGACAGTGTTACAGAGACCAAGCTCCTGTCACCATGGCAGTC
TCAGCACCCTCTGTCCCTTCTGGGGACTTTGGACTGAGCCAAGAGCGACAGAGCAGAGTG
CCCATCTCCATCCAGCACCTTGGGAAGCATTGCTTTAGTGTTACCTGCCCTTATGGCTTT
TACAGAGGAGGGATTTTGTTCATTTCTCACTTTTTGTTAGCCTCTTGGTCTCGGGCTGCA
GACTTCAAAGCAGCACACGTGTATTCATTCCATTAATTTCTCTTTTGACTGGTTTTGCAG
CAGAAGGGGTCAGAGAGCAGTAGCTGAGCACTCAGGGGTTGTCTTCTCAAGGTGTGGAGA
ACCAGGTACAGGAGCAGTTCTGCAAGGCTAGGGAGCAGCAGGCAGAGGAGGGACCGGAGC
CCCTCTCCCTGGTGCTGTGAGCACAGCAAGAAGGGGATTCAGCTGAGCTGAAGCAAGAGG
AGCCCAAACAGCCGTCCTTAGCCTGGATTCAGCCGTGTCCTCATTAACTCATGAACCACA
AAACATCCCAATCAACCCATCACCTTCCATCTACTGCTGTGAGTGGGCTCTGGACAGAAA
CTGTTATCTAAGGACTTTTTTTTTTATACTATCTGCCAAGCGTTTTCTCTTACATTTGTA
ATCTTACTATATTTTTCAGTAAGCTTGTGATATTCCAAAGGGGGAGGGCGATGCTGCTTC
TCACGGTCTCCTGTGCTTCGTGACGCTCTGGCCTTAAATCCACAAGCGGGTCAGGGCTGA
TGTCTGACAGCAGCAC
Chart Advanced