SelenoDB
Release 2.0
Chart Advanced
Transcript Report for SPT00000886_2.0
Identity
TranscriptIodothyronine deiodinase 2 (DIO2)
SpeciesErinaceus europaeus (Hedgehog)
Transcript IDSPT00000886
Transcript release2.0
External IDNone
Gene SPG00000790_2.0
Annotation
Prediction method(s)
(Selenoprofiles, Ensembl 68) [Report annotation error]
OrientationForward
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Full length Spliced 5UTR CDS 3UTR
 
Sequence
>SPT00000886_2.0 # Transcript # Iodothyronine deiodinase 2 (DIO2) # Hedgehog 
CTCCTTCTTTTTCTCTGCCCACAGGTGAAGTTGGGTGAAAACGCCCCCAATTCTAGTGTG
GTTCATGTCTCCAAGCCTGAAGCAGGTGACAACACTGGCAGGGGCGCCCAAGATAAGATG
GTGGATGGAGCCGAGTGCCACCTTCTGGACTTTGCCAGCCCCGAGCGCCCACTGGTGGTC
AACTTTGGCTCGGCCACTTGACCGCCTTTCACTAGCCAGCTGCCGACCTTCAGCAAACTG
GTGGAAGAGTTCTCCTCAGTGGCTGATTTCCTGTTGGTCTACATCGATGAAGCTCATCCT
TCAGATGGCTGGGCGGTGCCTGGGGATTCTTCTCTGTCTCTCGACGTGAGGAAGCACCGC
AGCCAGGAAGACAGATGTGCAGCAGCTCACCAGCTCCTGGAGCGCTTCTCCTTGCCGCCC
CAGTGCAGAGTTGTGGCTGACCGCATGGACAATAATGCCAACGTAGCCTACGGGGTCGCC
TTTGAACGCGTGTGCATCGTGCAGAGACAGAAAATTGCCTATCTGGGAGGAAAGGGTCCC
TTCTGCTACAACCTTCAAGAAGTCCGGCATTGGCTGGAGAAGAGTTTCAGCCAGAGATGA
AATCTAGATTAGCTGTTAAAGGTATGATTGCAATAGAGGCTCTTTTGTTTGTCTGTTTGT
TTTGATATGGAAAGGGAAGGAAACTCAGGACTGAATCCACTATTTCACTACGTCCCACTG
CCTCACTGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNACGGTGTTTAACATGTTAGTGACTGGTGTTCTAGTGTCTCTTTATGTATTAT
TCGATGCCAATTTAAAGCAGTCCCAGAATTCAGATGTGTGTCTGTAGAGACCAAGGATGA
CTCCCAACCTAGAGGGTTAGCATGATCACTTGAAATCTGAGGGTTACTTTCTAGTCTAGT
GGAAAATCAAATTGATCAACTATGGAAAGGAGGTAGGAGACACATATTAGGAGGCTTCCT
TGAGATTCAACTTGGAGCTGTAGAGAGTGGGAACAATTTATTTTTCACAGAAAGATGCAA
GGCCAGGCATAAGAAGAAGCCTGCTAAAACAGTCCTTGACTGAGTGAGAAACGGAGATGG
AAAAGGCAAAAAATGCACTTTGATATTAGTATTTATGAAGGTTTTTTTCTTTCTTTTCTT
CCTCCTCCTCCTCCTCCTCCTCCTCTTCTTTTTACCAGAACACTGCTCAGTTCTGGCTTA
TGGTAGTGCGGGGAATTGAACCTGGAACTTTGGAGCCTCAGGTATGAGAATCTCTTTGCA
TAACCATTGTGCTATATACCCCCCCCCACCTCATGAAGGCTTTTTTTATTTAATAATTAC
TTTTTAAAACCATGCTTGTGGTATGTGTATTTTCAGTTGGTGGATTATACTCCATGATAC
CAATTAAAAGTAAAACCAGTGGGCCCAGTGGTGCTGGTCTATGCCTCCCCATTCCTGCAT
TTATGACAACCAGTGGGCCCAGTGGCGCTGGTCTATGCCTCCCCACTCCTGCATTTATGA
CACGGCGCCATTCAGTGGGGCCTGTCCAGAAGTCTTTTCCATACATGCAACACAGGGAGT
GCGTGTGCTCTGCAGCCCAGCTACGTGCTCTCAGCTGCTAAGGGCAAGCACCTTAACCAC
TCCCTTTTCTCCTCCTCAGACAGGCGTTATCATGAATACGAGGTGCCAAGTTTTCTTCAG
TTGCAAAACAGAGAACGGGAGAGTTGTTTTGAGATAATGCCCACCAGTAGTTTAGGAGAG
GAGGCTTTGAGAAAAGTCAACCCTGACTAGCCTATTGCATTCGGCACTGTGGTATTCTCA
GTCTGTACTTGGGTCTTACATTGTTCCGACTGGCTGAGGTTTGATCATCTGAAGCCTCTA
CAGCATCCCAGAACAATGCCATTTTAATTTATAGGTGTGAATTCATACTTTTACTATACT
CTAAAACAGACTTGAAGTCTACCTGTGAGTAATATAATCTAAATATTATAACCTCAAAGG
AATAGATCAGCCAATTTTTGTATCATAGTTTCTACTGTAAATTTGAGTATTAAATCATAG
TATATGATTCTATGTATAGATACTATCAAAAGTTTCAAGGTCATTCTGTGAAACATACAC
TAAAACTAATGGGAAAAAAAAAGATCTAAAGTTGAAAATATCTTTCTGAATTAGTGTCAT
GAAATGATCAGAACTGTAGGAAGTGAGTGTCTAAGAACCAAATGTTTCTCTTTCTAACAG
ACTGGAACAGTACATAGGTGATATTGTATAGATATGAAAGCTTCATTTTAACTGATTATT
TTATAGCAGCACTTAAGGTTTCCAGAGTTTTAAATTCGGTAAGACACAGCCAGAGAGAAA
CAAAACAAGTTTGGGATTCCTGGACAATCACACTGAGGCTCAATTATTCCAGAATCCTCA
GCTGTTCAACCTTCTCCTGAAGGCTGGTCAGTGGGCCCCACCTGATCTAGAGAAGAGAAA
TGAACAGCGGACACGCTGTGGTCCTGAAATGTCCCCTTGGTTCTGCATATTCAATAGTGG
AACAGGATGTTCAAGAAGCTGGTGGGGGGAATGCAGTACAGCTAAGGCTGTCCTAGTTGT
CTGGGGGAAGGGATGATGGCAAGAATCACCCCACTGTGATTTATGTGTAGGGAAAGAGAG
GATGCTGTGGGCATAATTCCTCTCCCCAGGATAGTGCAATGGTGAAATGAGGCAAAGTAA
AGACACGTATGAGATGGCATAGGCTGAATATCAGGGAAAAATGAGATGTTCCTTAGAACA
CTGAAGAGCTGCTGGAAGAAAGATTGCTCAAGGGTCAATGGCGAAGTGGATTGACAAAGC
TCAGGAATCCTACAATATGTAGAAAGGCTTGGTGTTGGAGTTAGGGTAAACCTGTAATTA
TATAACTTATTTATCTCAACAAAAATGTTTATGATTCCTTGTAATGTATCATTTCTATGA
AGATAAGAAGTGTTGAGTTCTCACAAGAACTCATTTGAGGCGGAGAAGAGTCAGTGCTTA
ACTTATATGCTTAGAGAGAACATTAGATTGCTAGTATGGGTCCCATTTTACCAAAACGAG
TCCTCTTTGTACCTATATGTTACCCCCGTGACCTCCCAGTAGGGTGTGTTTACATGAAGC
TATCAGTTTAGCCTTAAAAACACACACACTGAATTAGCTTGACAGTTATTGAAATCATCT
CCAAGCCATTTTAGATAATACCATTATGTCTTGGAACTAGTCACGACTCGACTTTATTTT
ATTGCTTAGAGAAAACATTTGTGGACTCCACAATGACTTTCTCAAATGGGCACGAATGAA
ACATCTGCACAACAACGTGGAAGTGTTTTGCACAGATATCATGATGCGGGCAGACAGGAA
CTCTGCTCCTGCTTGGTGTGGCTGCCGCTGCGGTCAGTCTTTCACCCTTCATGAGTTTTT
GAACTCATGTTGCTGGCCCTGGGTCTTTGTCTTCAGTTTGTTTCTAGTATGTGCTCCTGA
TTTTTGGTAATAACTACTCTTATATGACCTACTTAGGCAGTTCAGTGTTCTTCCCCAAGG
AGCCTGATAACAAGGAAATACTCCTGCTGTCTTTTTTTTCCCTATTTGGATTCATGAATA
AAAATCATGAAATATTATATCACATGTGGGTGGGTGCAGGTTAAAGACATTATGTCTTTG
CCAGAATTCCCAGCTGGACCCACAGGCCCCCAGAATGCCCTGAGGCTACATCCACTGCGG
GGGGGGGGGGGGGGGGTGGGGGGAACGGTTTGCCCGTCTCCCTGGTCTTTTGCTCAAAAA
AAGAAACTAGCAATTTATTTCACCTGGGCTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCCCCCCCCCCAGCCCCC
CTCCACAGCAAATGGCAGCATATGTATATGATAGAAGCCCACAGACCGACCACGCGAAAT
GAGTAACGTCTCTCTCAAGTCTTCTCCAGCTCACGTCCACTATAGTTCTTGTGTGGGTCA
GGTGCTGGGAGGCTGTGCAGACATAAGTACCCAGTACTTTATAACCAAAGCAATGCAAGA
TAGTAGGTTTTATTTTTTATACCAGTTTCGTTTTGTTTTGCTCCACACTGTCACTGGACT
GTCACTAGCCCAAAGAATTGAGCACCCGAAGAGACAGACTGGGATGGGCAGAGGTCACTG
GTGTGTGAATGATAACTACTGACGAAAGAGTCAGTGACTCAGTCTGTGGTTGGATGTATC
CACACCAGTC
Chart Advanced