SelenoDB
Release 2.0
Chart Advanced
Transcript Report for SPT00000750_2.0
Identity
TranscriptGlutathione peroxidase (GPx)
SpeciesDrosophila melanogaster (Fruitfly)
Transcript IDSPT00000750
Transcript release2.0
External IDNone
Gene SPG00000654_2.0
Annotation
Prediction method(s)
(Selenoprofiles, Ensembl 68) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Full length Spliced 5UTR CDS 3UTR
Forward Reverse  
Sequence
>SPT00000750_2.0 # Transcript # Glutathione peroxidase (GPx) # Fruitfly 
GCCGAGCAGCAGCTCTATGTCATCGGTCAGGGCAACTGGTTCCAGTTCGGCGCCATATCT
CTTGTGGATGTTTCCCTTTCGATCCACCAGAAACTTGACAAAATTCCATTCGATATCATG
CTGGTGGCGCGTTAGGAGCTTGTACAGCGGATCTGCCTGAGCTCCCTTTACATCTATCTT
GGCAAAGAGGTGTCCTATGTTGGCTCCCTCCCTGCGCAGGTGATCCAACATTTCCTGGCC
ATCGGACTCGGGCATTTGACCCCCAAACTGGTTACAGGGAAAGTTTAAAATTCTCAAGCC
CTGGTCTTCATATTCCTCGAGTAAATAGCGCAAACCGTTGTACTGAGATAAAGTAAGTCC
GCATCTGAAGTAAAGGGTGGGCCAAGTTATTAAGAACTTTCTGTGGATCATTCTTACTTG
GAGGCAATGTTGACGATAAGCAACACATGGCCGGCGAATGTATCGAGTTGCACTGGATTC
CCAAACGTATCTCGAACGGTGAGAGCGTGTATCGT
Chart Advanced