SelenoDB
Release 2.0
Chart Advanced
Transcript Report for SPT00000613_2.0
Identity
TranscriptGlutathione peroxidase 1a (GPx1a)
SpeciesDanio rerio (Zebrafish)
Transcript IDSPT00000613
Transcript release2.0
External IDNone
Gene SPG00000517_2.0
Annotation
Prediction method(s)
(Selenoprofiles, Ensembl 68) [Report annotation error]
OrientationForward
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Full length Spliced 5UTR CDS 3UTR
 
Sequence
>SPT00000613_2.0 # Transcript # Glutathione peroxidase 1a (GPx1a) # Zebrafish 
ATGGCTGGAATTAAATCATTTTACGACATCACAGCCAAAACTCTTACAGGAGAGGAGTTC
AAGTTCTCTTCTTTACAAGGCAAGGTGGTGCTGATCGAGAATGTGGCTTCGCTCTGAGGA
ACCACCAGCCGGGATTACACTCAGATGAACGAGCTGCACGAGCGCTTCGCGGAGAAGGGG
CTCGTGGTTCTGGGTGTTCCCTGCAACCAGTTCGGCTATCAGGTGAGATTCCTGATAGAG
CCCTTCAGAACAAGTGTCTGTCTGTCTGTGGCGCACTTCAGCTCTCACCTTGCCATCCTG
CTCAACACCTGCTTTACTGTATGCTGGTTCATCTCTAGCCTATTTTAATCAGTCATCGGT
TTTAATAAAACCTTTATTGATCATTATTGGGTTGATCTTAAACTATGATTTTGCTTACAT
TTTATATTTGCACCTAATTGTTTTCATTGATTAAAATTTCTAGTAAATTTAAAAAAGCAA
CGTTTGGAAAACTTTATTGTAATAAGACTTACTCCTACTCCGTTTAATTAGTTTTATAAT
TAAAACAAAAAGGTTCTTCTCCTCCTCCTTCTAGTACTACCACCACGACTAGTAGTAATA
ATAACAATATGCTAATTTTAAATTATACATTGAGAACAATCATGCTCAGCAACGACTGCA
TACACTTGAAGGCATTCCGATTGCAATGAATAGGGGATGAGGAATGGAAAAGTATTTAGT
CAAACTCAATAGAATGGGCTTGGCAAATAATAATAATGTTTGTTGGAAATGTCAAAAAGA
CAGAGGTGTATTTATTCATTGTATTTGGGACTGTTTACTAGTTCAGCCTTTTTGGCACCA
AATCCTAAATATTATGAGTAAATGGCTTGGAACAATAATGTATTAATACCACTGTATTAA
TACCACAGTAATGCCACTGTCACCAAGGTTATGCTTACTGGGAGGTAGGGAACCAAATAT
TACAAAAAGAAAGTTCACAGTAATCATGGTGAGGATTTAGGTAACGGCTAGAGCCATTTA
GAAATACTGGAAAACTCCCAAAATTCTAAAGTTAAAAAAATGGCTCAATATAACGACTAA
AACAGCTTTGTATGAACGTTTAATACAAATGACGCAAAAAGGACAATGTATCCCAGTGTG
GGAGGACTTTTTGGTCTTATGCGATGATGTCTTGTAACAGGTTTTCTTTATAATATTGTA
CTTTTGTCCATATTAACCACTGGATACATCCTGGCTTTACATTTGTGATCATTCAGTGTT
ATATGTATTTGTATTTTTTCATTTACCAGAAAACAATTTTTAAAAATTTGAATTAAAAAA
AGTACATTGACAACCTGACTGAAACAATGTTCAGTGAAAATTATTAGTAAGTCCCTTAAA
TACTGAATTAAGCATAAAATATAGAAGCAAGAAGTTAATATTTAACAACAAAAAAAAAAA
CACCCACAAACTAAAAGCATGTAATAAACTTTAAATAAGATACATTAAGCTAAAATAACT
AAAATTAGGCCAATTTTCATAAACAACTAGTTTAATTAAACAAAACATTGCAAACTGATG
AAAATGAAAAAATGGACAAGGACTAAATTAGGCTACAAGTTACACAAAAAAGTATAATAA
ATTATAAATGCAAACTGACCAATAAATATAAACAAATTTAAACTTAAAAGAAAAATGATT
TAAGTGCATGTTTTTCAACACATCCCATAATTTCTAATATATCAACCTCCACCAACTGGT
ATATATGTTGGTTTATGGTAAAAGTTCCTGAATTATTCCATATACTTTGGAAAATATGAA
GTGTAAGACCAATTTATTTGAACAAATATTCAAAATAAATCATTTTTAAGTATCTTTTTT
TTAGTGTTCCATAAAATATTTCAGATTCTCATTGAACATGTCTTCTTGTTTTTGTTGTTT
ACAATAAAACCAAAATCAAGTGTAGTAGTGCAACAGGATTATGTTTGCTTGATTTTTTGT
AAACCAACAATGCTGTGTGTGTAAACCATTATGTAAAACAGTCAAAACATGGTCAACCAT
TTGGTAGAGCAGGAAGTTGAAGGCTTAAGTGGTTTCATTCTAAGATAAAATAATGATTTC
CTTTCCTTTTTCAATCAAAAATATTTTAAGACAGAATGACTAATGACTCAATGTGTAGGC
CTATCTATTTACTAATATATAATAATCACATTTATTGCAGAGTATTACCAAAATAACTTA
AATGTTTTTTTTTTTCTAATTCCATCACCAATCCGTCTTTGTTTTAGGAAAACTGCACAA
ATGAAGAGATCCTTTTGTCCTTGAAGTACGTCCGTCCTGGCAATGGCTATGAGCCCAAAT
TCCAGCTCTTGGAGAAAGTGGACGTGAACGGGAAAAACGCTCACCCGCTCTTCACCTTCC
TCAAGGAGAAGCTTCCCTTCCCAAGCGATGAGCCAATGCCGTTCATGAGCGACCCCAAAT
TTATTATCTGGAGTCCCGTATGCAGAAATGACATCGCCTGGAACTTCGAGAAGTTTCTGA
TCGGGTCTGACGGAGTCCCGTTCAAGCGCTACAGCCGGAGATTCCTGACCAGCGGCATCG
ACGGAGACATCAAGAAGCTCCTCAGCATCCCAAAATAACAGGGTTTTGGGGTCTAACCGA
TGTCCCGTTCTTGCTTAGCATAGCATGCGTCGGTCTCCCTGGCAGGTTTGTGCTCTCATA
TGTGTAAACGTTGCTGAGTTTGGACTTTTACTTCATGAAGATGCTCCTGTAAACATGCTT
GTCTGTCGGGAGCAGCTGATGCCCTGCAAAAGTCCAGG
Chart Advanced