SelenoDB
Release 2.0
Chart Advanced
Transcript Report for SPT00000308_2.0
Identity
TranscriptGlutathione peroxidase 7 (GPx7)
SpeciesCallithrix jacchus (Marmoset)
Transcript IDSPT00000308
Transcript release2.0
External IDNone
Gene SPG00000211_2.0
Annotation
Prediction method(s)
(Selenoprofiles, Ensembl 68) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Full length Spliced 5UTR CDS 3UTR
Forward Reverse  
Sequence
>SPT00000308_2.0 # Transcript # Glutathione peroxidase 7 (GPx7) # Marmoset 
GAGCTTCCTCACAAGTGCTGTGATCTGGGGTCTGATCTCCTCCACTGACACGGTTGGGTC
CCAAGCCCCTACTACCTTTCCATCTGGGGATACAAGGTATTTCCAGAAGTTCCAGGTGGG
CTCCTTCCCAGAAGTCTCTAGAGAAAAAGGAAGAAGGAAAGCAAAGTGTGCTAGCCTGTG
TACCCTCTCCTGGAACTTCACTCTCAGTGTCCATCTTTCCCTAGTGGCAGCTAATCCTGA
TGCCCAGTCCACACTGCAGACCACTCCAACCAGAATCTCTGCAGATGAGGCTCAGGCATC
AGCATTTTTCAAAAGATCTCTGGGAGATTCCAATATGGGCCAAGATTGAGAATGACTGCT
TTAGGATTCTGTGATGTGTCTGATAAAGTGGTATCAAATCCTCCTTTATTAATGACCTCC
AACTACTGAATAGTCTACACCCTATTCTCTAATTCAGTTTTAATGGTTTCCAAATGTGAG
TCTGTGGACTGGTTGCATCAGAATCACTGGGGGGCAGGGGAGTGCTTAAAATAAGATTCT
TGGACCCTACTTCAGTAGGTCTCAGGCTTGTGCATTTTTAAGAGCTCCCCAGGTGCTTCT
AAAAGCAAGTCCAGGTTTGATCTATAACTGCGCGAACTGGGAAGGAACTAATAAAAGAAC
ACAGAGAAGAAAACAAACATTAGGACTGACCCACAGAGCAAAATGCAAACCTGCCTCTGT
AAGGGACCTTTTGTTTGCTGCACTGTTGCTTCTCATTTACTCCTCCAGGTGAATGGGTTG
CAGGGTGGGGTGGTGGTAAGGGATACAAAGGCCGCTGGAAGCATGGAGTGAGAAAAGGCA
AAAATAGGGCCTCCAAAGGAAGAGAAGGCCTGAGGGAAGAAACAGGGTCATAACGACAAG
CTTAGCCCATGACCCCATTCTATGGCTCTGAGGCTTCTGCAGCTGGAGAAGGGATCTATT
TCTCAAATATTAAGATCTGGTATTTTAGCTCAGAAGGTCTCCCTCCATGGCCTAAGACTC
CACCGCTGACCAAGGGTGGAGATGCCTGTCCGCCATCTTGGTCAGCTTTCTCCAGGCAAG
TGGCATCCTCTGTCTATGCCTTGGTTTCTCCATCAGAAGTCCATAAACTCATCTAATTCA
CAGTGACTCAAATGTCTCCTTTTAGGAGCCCCTGAATGTGAAAACAAACAGGATCCCTTC
TGAGGGAGAAGTGAGAGGCAGCAGGTATAGAGATATTCTTAGGCAGGAATACCCCTCAGC
TTGTACCTGCCTTCACTTTCCTCAAAGATTAGTGCTGGAGTAAAGCATCAGTCCACCTGA
GAGGGTCAGGAAGGGGAAGGGGCCCCAGGTCACCCAGCCAGCCGGTGGCTTCTGCTGCCC
AAGGAGCCATGGCCTCAGCCAGCTGAGGGAGGTGTGAGGGGATGAAGAGACCAGGACTCA
CGGGCCAGGTACTTGAAGGCAGGGTGGGCACCAGTACCAGTGACTGCAATCTTGCTAAAC
ATGGGAAATGAGACACTGTAGGTACGGCGGGCAAAGCTCTCAATCTCCTTGTTGCTGTCA
GGCTCCTGTTGGCCAAACTGGTTGCAGGGGAAGGCAAGCACGTTGAAGTGGTGGGGACCC
AGGTCCCGCTGCAGCTGCTGCAGGGCTCGGTAGTGCTGATCTGTGAAGCCGCACTCGCTG
GCCACATTCACCACCAGAGACACCTG
Chart Advanced