SelenoDB
Release 2.0
Chart Advanced
Transcript Report for SPT00000186_2.0
Identity
TranscriptIodothyronine deiodinase 1 (DIO1)
SpeciesAnolis carolinensis (Anole lizard)
Transcript IDSPT00000186
Transcript release2.0
External IDNone
Gene SPG00000089_2.0
Annotation
Prediction method(s)
(Selenoprofiles, Ensembl 68) [Report annotation error]
OrientationForward
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Full length Spliced 5UTR CDS 3UTR
 
Sequence
>SPT00000186_2.0 # Transcript # Iodothyronine deiodinase 1 (DIO1) # Anole lizard 
AACAGGCCTTTAGTCCTAGCATTTGGAAGCTGTACCTGACCTTCATTTATGTTCAGATTT
GGAGAGTTCAAGAAGCTTATAGAAGATTTCAGTTTTGCAGCAGATTTCCTTGTGATCTAC
ATTGAAGAAGCCCATGCCTCAGGTGAAGCATAGTTGCTGTAGCTCTCTCTGCACAGTACA
TGAAGCATATAAACTACAGCAGTGATTCCCAAAGTGGGTGCTACCGCCCTCCAGTGGGTA
CTGCAGCGATCCAGGGGGGTGGTGATGGCACCTATTAGGACAAGGGGGCGGGGCCATAGG
AGGGGCGGGGCCTCTTCCCTTATCCCCACCTCTGCCATAAATGTGAGGATTTCCTGTCCC
AACACTGATCCCTAACTGATGTTCCTGTGGCTCCCGTATGGGATTTTATTTCATTTTGCC
CCAGACAACACCGCTCTTTATTAACTGCTGCCTCCACAGACACTCTGTCTGAACTCAAGC
TTTACAATATGTAGGTTTCTGTGGTCCAAGTATATAATAGAGAAATGCCTTATAAAATTG
AAAATGAACATAGCATCACAGATACAGGATGTCCATCTGTCAGGAAAGTTTTGATTGTGT
GTTCCTGCATGTCGGGGTGGTTGTCCCTTGTCCCTTTTGAAATCTATGATTCTAGATTGC
TTAATTAATACATATATCTTGACTGAACTCATTCTAACATGCATATCTCATTCTCTCTCA
TATCCTAAAACTCTAGCTGTCCTCTAGATCTGATCTTAACTCTCCTAACCATGGAGAATC
TTAAACCATACTAATTCTTAATTTTAACATACAGCTATCATTCCTGACCCTGTCAAAACA
CCAGCCTTTTCAAAACCTCTTCAGACATTCCACCAATCACTCACTTCCAACACTGCATTC
TCTCGCCTCTTCATGAGGGATCCTTACCTTAAAACATCTACATAGTGCATATAAACCTAT
ATTATATTAATATCTACTAAATGAAAGAACCCACCCCCCCAACAATTCTAGAAAATTATA
ACTAGGTTATGACCACAGTTAGTGGAGGAACAAAGGTTGCTTAAACCTCTTCCATCCCCA
ATAGCCCAATGAGGATTGAGTGTTTGCTTTGTGGTTTCAGAATGCTAATTGGAAGGGGGA
AACACAGAAAATAGTGTGGGTTTGAATTGAATAGTTAGGATCCTATACATTATTTGGATT
GATAAATGTAAATATGAAAACATGCTTTGTAATGTGTTTAACCATACTCTTTGTTTTAGA
TGGATGGGCTTTTAAGAACAATATTGTTATTAAAAGTCACAGAACTCTCCATGATCGTAT
GCAAGCTGCAGAGATCCTGCTAAAACAGTACCCCTTATGTTCAGTGGTCATGGATACTAT
GGAAAACCTGAGTAGCTCAACCTATGCGGCTCTTCCAGAGAGACTTTATGTGCTTCAAGG
GGGAAATATTGTCTATAAGGTAACAAGTGTTAAGTAACATAAAGTGACTACAATCATGTA
TAGCTCTATGTGGATTGGGGAAGCACCCAATTATATTGCCATAGCAAGATATAAAATTAG
TAAAGCAGGGTTGAAATCTCTGGACTATTCTTAATATAATCATTTTGCTTCAGGATATGA
GGACATAGCCAGATGGTTCTGATCCTACACACTCCTCACAAGGCACAGGATAGTGGTGGT
GGGGCCTTCTGTGCATTTCCATGTAATGTCATTTATCCTTTAGGTTCTGTAAGGAAAATA
ATGCCTACCAATGGCCTACATGAGGAATTGTAATATTTGCGTAATCAGAAAAAAATGAAA
ATAATAATTGCAGTATCATATTTTCATAAAGTGTAGGAAAAAGATTTCCTTCTCTCTTTC
AGTTTTTTCCTGGTTTCTCCCCTACACCCTTCAATCATTTTTCCAGAACTGTTCAGAAAA
ACACCGTATTTTTCCTTTTACAGGGTGGAGTGGGACCATGGAATTACAATCCACAAGAAG
TCCGTGAAGTTTTGGAAAAACTACTTTAAACCTATAAAACAGATGTGGTGCTCACATACA
TATATGGTCACTTCCTAGTCTGGTTAATTTTCAAAAGTATTAAAATACCTTTAGAAGAAA
AACATTTTTGGAGGATAAAGCCGCATTAAACTGGAAAAAATGAGAACTGACATACTATCA
ACTAAGTGTTCAGCAGTCACAATTTGTCCATAGAGTACAAATATACACATTAAATTAGGC
ACTGAATAGCTATATTTACATGACTACCCGCAAAATATCAGTCATCTTCGCCTAAGGAAT
GTATATAAACAACAGTGGCACAATCAGCTGAGAAATAACTGTATGGAAACTTTTTTTAGG
GGGCACCTTATCTTCCTATGATCAAATGTAATGCTTTGAATGTCTACTAGCACATAATGG
CTTTCTGAATTGAACTGTTGTACTCATTAACTTCATTTTGTTTCTATTTGTATTTATTTA
TGATAGTCATAGCTTAAAGCATGAAGAGCTGTGGCCTGATTTGGAAAAAATAT
Chart Advanced