SelenoDB
Release 2.0
Chart Advanced
Transcript Report for SPT00000010_2.0
Identity
TranscriptIodothyronine deiodinase 2 (DIO2)
SpeciesHomo sapiens (Human)
Transcript IDSPT00000010
Transcript release2.0
External ID ENST00000556811.1 (Ensembl)
Gene SPG00000002_2.0
Annotation
Prediction method(s)
Curated external database annotation (GENCODE, 15) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Full length Spliced 5UTR CDS 3UTR
Forward Reverse  
SNP (Present-day Humans) SNP (Neandertals)
Sequence
>SPT00000010_2.0 # Transcript # Iodothyronine deiodinase 2 (DIO2) # Human 
TACTCAGCCCAATGCCATTTGAGTAGTGAAAGAAGTATGGAGCTGTTAGAGATTCATGTT
CTTCCGATAGATAAACTCCTGTCTTTCAGTAAGCCAATAGGGCTCTGTTGAAATATGGAT
TCAGTTCTTAATTTCCTTGCCTTTATATAACTTTTTAAAACAATAAGCTCTCTTATAATC
ATACCTTTAACCAGCTAATCTAGTTTTCTTTCATCTCTTGCTGAAATTCTTCTCCAGCCA
ATGCCGGACTTCTTGAAGGTTGTAGGAGAAGGGGCCCTTTCCTCCCAGATAAGCAATTTT
CTGTCTCTGCACAATGCACACACGTTCAAAGGCTACCCCGTAAGCTATGTTGGCGTTATT
GTCCATGCGGTCAGCCACAACTCGGCACTGGGGCGGCAAGGAGAAACGCTCCAGAAGCTG
CTGGGCTGCTGCACATCGATCTTCCTGGTTCTGGTGCTTCTTCACCTCAAAAGACAAAGA
GGAGTCCCCCGGTATCGCCCAGCCATCTGATGGATGAGCCTCATCAATGTAGACCAGCAG
GAAGTCAGCCACTGAGGAGAACTCTTCCACCAGTTTGCGGAAGGCTGGCAGCTGGCTCGT
GAAAGGAGGTCAAGTGGCTGAGCCAAAGTTGACCACTAGTGGGCGCTCAGGGCTGGCAAA
GTCAAGAAGGTGGCATGTGGCTCCCTCAGCTATCTTCTCCTGGGTACCATTGCCACTGTT
GTCACCTCCTTCTGTACTGGAGACATGCACCACACTGGAATTGGGGGCATCCTCACCCAA
TTTCACCTGACGGTAAAAAAAAAAAAAAAGAAGAAGAAGAAGAAGGTGAGAATATCACAT
TAAACACATTGCCACTTGAATTCACATTAAATAGTTACAATTGGCTCTAATAGAGTGTGG
TATTTCCTTCAGAGCATTTGGTAAACATTTATTGATTTGAGTAAAGAGGCATGATGGCAG
GTAATGTAAAGAATGGCCCAAAAGACAATAAAAGTCTTTTTCATTCTGTATAGTCACTGA
AGATAATTATTTTCATCACTGAAGGCACTGGAGTTAACTCTTTTTAAAATTAAGCCAAGG
CTGTTATTCTTTACTATCCTTATTTTGCTGTCAATTCTTAACATGCATTCTATAACAAAT
GATTAATTGACTTCATTTTAAAAATTAGAAGCAAATGGTCTACTTTAAGACAAATTATCA
GGGTCTTGGGACATGGTCCCTCTTTCTGAATTCTGAAACACCAGGCAGGACCTTCATTTT
CTTGCATGATACTAAGTCATTTAATCTCAACCAATGGCCAGTGATACCAGTGGGCTCTAT
TCTTGGCCAGATCTAGAAAACCTGAGGTCTACCACTTATAAGAAGTGTTACTTCCACTTA
ACCTCTTTAGTGATTCAGCTTTCCCACCTGTAAAATGGAAATAATAATGCCTGTCTTCCA
CATATGGCAACTGGAGGACAACATGAGAAAAAGAGCTCTTTGTGCACTGTAACTCTATGG
GTGTGTGTTGTCCTTATCAGATGCTACCCCACCATGTGAAACAGAACATCATCATTCTTG
GGCAATTCTGTGTTTGTTTTTGTTTTTTTAAATGCCCTGAGCAAAGCTTTGCACTCTCCT
CAATATGGCATCCTCCCTGGAGGCTTCTACTGCCACTGCTTACAAGGTGGTTCTTACCAC
TCCAATCTTACAATTTCCATTTAAAAAAAAAATAAAAACAGACAAAAAAACAAAAATGGT
TACTCCAGAATTCTACTTTAAGTCAATTTCTCATTTTCCATGTGTGCTTGTTTCCTTCTT
TTTATCTAGGAAGTCACATTAAAAAGTACTTTTCTACCCCACAATTTGTTAACAAGCTCC
TCTGAATTATAAAATATTGGGGCAGAAGAAGTAGAGATAAAAATTGTTTCATGTGCTCCC
TTTGCACATGGTTTAAATAGTTGAGAACAGAATGAAGGAAAGTTTGCAGCCTTTGAATCT
GTAAATTGATCATAAAAAGCAGGCAACAATAAAAGAGCCAATTACTTCAGTTTGAATTAA
TACGATTGGATCTTCCTTAGAATGGTTTAATCAAAGCCAATAACATTAGGGACAATTTAG
GGACAGTACAATTGATTTTTATATACTATCCTTAATATTACAATATACTTCCAACTGGGT
TGACTTATTTCCCTCATATACATACAGCCACACATAATGCTACTGTTAATTGAAGTCACT
TCGAAGTGAATTGTTAAAGATGTAACAATCCAAACTGATATAACCCACTCAAGGGCTTTT
ATTCAGAAGCTTCTATCTAATGTTAATGCATAACTCATTTTAACTGTAGAGAAAGAATTA
AAGTTCTTTCTCTCCCTTCTGAAAAATCCTAGCAGGGAAGGTTTGAAATAAGCATTATTA
GTGTTCTAAGAGAAATCTTACTGTAATAATCTTCCTTCTCAGAAAGGAAGCTGCTGGTGT
GATTTAAGTAAGTACATTTGTTTTTTAGTCACCACCACAGAGAAAATTATTTTACTTATA
CTAACTTTCTTGATTAATTTGCAAATGACACTAGATGGAGAAATCTAATAAGCACATTTA
GCTGGATTCTTTCATATGAACTACCCTAGTCTTTAAGGCATGAAAATATACATCAAATTT
AAAGATATGTTGAAGGTATTATTAACCTTTTAAGCCGTGAGTTCTTTTTGTACTTCTTTT
TTTTTTATAGATCTAGGTAGTGGGTAGCAGTCTCTTCTCTTTAGATCTTTCCCATTTGAA
ATAATAGTAATGATTCTAGAAGGGGTGTTTTAACAATATCATGTGTACTGTGTGCCTCAA
CGTACCGTGATAAGAAGACCTAAATGCATTCAGATTAGTCCGTTGTAGGGACTTCCTGTT
AAGTAAGCAACCTGTACACTTGTAGGTTCTTGATAGGTAAAAACATTCATCTGCATTTTG
GAATCATTTTTGAAACCCATGAACAATTATGTGGCCTTGACAAATGCGCCTCTAACCCCC
TGATTCATCCGAGCAGACCTGTTGATCCTTTCATTATGTCTGATTATTCAACTGAATAAT
CTAATCTGTTGCTTTAGTCACAGGGGACTCTCTTATTACCTGCAGTAAATTTTCTTGGAA
AGTTAAGGCACCTTCTCCTTCTTAGAAACAATGTATAGTTCAGCTGCAGAATTCTTTCCA
AAACACAGACTAATTTGCCTTGGGAAATTTAGAGTAAGTACAACACTGTCAGTCTAAAAT
AAAAAAATTAGGAAAGTTACCAAATTCGTAATGCTCTTTATGGGGGGGATTTAGCATTTT
GTTAGGATTAGGGTTAGACTGGGAAGTATTTATTTTATTGAATGAATGCTAGTTGTTATA
ATTCTAGGTCAGTGAAGAATTTTACACTTAATGATAACCCTGACCTGCAATGAACATAAT
CATATTTGGGTGACGGATAAGCTCACTGAGGCAGATAAATTTAGAAATATGAATCCTGGG
GCCCTCTCATAGAGTACTACCAAAATCAGCACTCAATGTTATTGATCTGTCCTTGACAGT
CTCATCTGGTCAGTGCACAAAACAAATGTGGCCTATTATTTTTATTTTGTTGAGGAGCCA
GGGTCCCTTACTGAATGTTATAATGTCATAAATGGATATGCTTATTCATGAAGGTGCCTA
GGCAAGAGAAAATGCATAGATAAAATTAATATTATTAATAAAACTAAGAAGGAAAAACAC
ACACCCACCATCCATAAATCCAAATGTGAGTAGACCAGTAGTCTGCTTTTATAAGCTTCA
TATACTAGTCATAAAATGTGTCCATCTTTGCTAAAACCTGATGGAGGACAATTTAGCTAA
AATAAAGAAAAAAAACTTTTTTTAGATATGGAAGTTTCCTTTAACCTAAAAGAAAATATT
CTAAAAGGATATTACTGTTCATTCTCATCTCCCCATTTGGTCACCATAAAAATTAAATTC
CTAATAGACCAGAGTTTCAAATGGAGAACTTCTTGGTTTGCTGGGTTATGCACCCTGCTG
AGACAGGCTGGGAGAATCACCATTGTCTTCGATGATGGAAGATTCTTTGCTCTCCCCACG
AGCAAAGCATTCCTTGACACAGAGCCAAAATGATGAAGAAAATAAAGTTGGTCCCATAAT
AACATTTAGGCTGCAGGAAAGAAGCTCAACAAAAACAAGTTATCCCCTGGTACTCCCAAA
CTTTGTTTTAATTTCCCACAGTGGCACAGAAAGTCTGGCCACAAGTTACCTATCATCTTA
ATTTCTCCTTCTTAGAGGGTTTGTGTTTGGTTTTTGTCCTTAATGAGACATATTTGCCAA
AGAGGCATTCAAAAGGCATTTTTTACTCTTGCGGAAGAGTAATTAGGTCGGTACCTCTTT
CCCTGCCAGCATTAGCCGCTCTAAAGAGAACCCTGCCCAGTATTTAATGCCCAAACACAA
GAAGCATCATTTCCACTAATTGGTCTTGAAGTTCCGATGTTCCCAAAGGGTCCCTTTATT
TTGCAAGGATCAGAAAGGACATACGTAAAATGTGATATTGTCATCGCTGACTTTTATCTC
TCTCATCTGCACTATTACAGTGGTCCTCTCTTATGTTTTTGCAAGCAACATCAACACAAC
ACCAACAAAGGAGGTAAATAAAGGATTTGCATTTTTACAACAGAAGACATCTCCGGGCCA
AGTTCAAATGTTGGAATGGAAATCTTTATAAATATGAACATGAACATAAACATATAGCAT
ATATAAAAATTTGATTCCCTTGATGATGTTCAGTGTTCAGTGCATGGGGAAAAAGGAAAT
GCTGCTTTAGCATGTGGACTGTGAAATGCAGGGCAAGGGGGAGAAAAGAACCATTCATCA
AGTAGAAGCAGAAAATACAGCATATACTACTAACCTTGTTTCTTGTTTTGGGATTTTATT
TCTTTTTCTTTTCCACAGCCTGAGAAAGCCTTGTGGACAATATATCACATAATCTCATAA
CAGAAACTAAAGCAAATTATAAAAATGAAGGGTGGGTGTGTGGTAGCAGAATTTTCACAC
ATACTACTTGCTATCCAAAGCCCTGAAAATGGCTTTATTAACTATCAGGAAGTTTCAAAT
TCTTTGACATAATGACCAGGCTACATCAATGTCCTTAGAAACATGGCCAAACTATCATTA
AGAAGAGATTTAACCATTTATATTCAGATTGGCCAAATAAATCAGAGTTGAAGAATAGGC
TACGTACTCCTTCCTCTGAGCTCAATTCCCTTTTAGCTATTCTCTTTTTAATTTGTACCT
TGAAAATGTAGCTCTAAGCTCTATCATTCCCCAATGTTTTATCCAAGTGATGGACAAGCT
CTGGCTGTGGCCTGCTTTGTGTTCTTTTGGGACTGTTTCTCTCTTAAAAGGGCCATTTTC
CATTGTGGAAACTAGTGTCAAAGGCTTGAGGTGAATGAAGAGGAGGAGGAGAATGTTAAA
GAGACCCTTTCAAAACCAAAATTATATGTTCAAATGAATATGTTTTCTGTACCTCTGCAA
TATTAACCGTGCAGAAGCTAAACTGCCTGTCAGCATCTATACTGTGTGTTTACTTTTACA
CTTCATTTAGGTAAGAGCCAGGCTCCCAGACAGAGCAATTTGCTTATTGGTTGCATGTTT
TTAGTCTCTGAGCGCCAGCACAAGGATATACTGTTCAGATGCAATGACGCTGACTAAAGA
AACTTAAATAACAAACACCTTTTATTCACCTCAGGGTCTCTCACCAGTGTCTATAGACTT
TCCTTTCAATCAAAATTGTACACAGAATCCATCTCTTACTAAACTCACATTATCTTTAAA
GGCTTCTCCATAAAGTTAATTCAAATCCCTTTCAACCTTTTAAGAAAGGGTTTATTTAAA
AAAAAAAGAAAAGAAAATATTTTGTTCTTTCTTTATTTCTGTGTTGCCCCTTGTGGAGGC
AAAACACAGGGATAATACTTTTACTCCACTTTCTCTACATATCTTTCCAGGCATCTGACA
TGCAGCAACAAGGAGAATTAATAACAGTAAATCACATGTGTAGTTGTATCACATGAGCAC
ACACCCCTCTCATCCTGGAAAACTTCACTTCTGGGGATGGGTAGCCTCAAAATAATGCAA
GTCAGGGTTATGAAATAGTGTGATGCCATCTCAAACAGAACCTCTTACAACGTCTCTGGA
AATGACTACACCCAAAGACAGTGGCACAAATGACAAGAGCATTCAGAGAAGTGATTCAAC
CTGGTTGAGAGATTCTGAGTGACCCTCAAATGCCACCACAGAAACCACCACCCTTGCCAT
ACTTGAAGACAGAAAAGAGACCATCATTCAGTTGCAGCTGTGTTCATAATGTTTCCATTT
ATCACACACCCAGTCCAGTCTTGTTTCTGGATATGTGGGTCCTGGGGTTGCTTCTGCACA
TGGTAGCTATTACATAAATCATCAAAAGCAAACATAATAACATCAGTCGTGAACTTGGTC
ACTAATCAAATCAGTAGGCAGGGACAAAGAAATACAGAATAGGAATATACAAACCATATG
CAAAAAGAAAAAACAAATCACTCATCCTTCCCAATTTCCTAGAATAGGAATAACAACATA
TTGCAACATAATGGAACACTATACATTGGTGAAAAAAACAATAAACTTTATTGAAGACGT
ATTTGTTTGCTTTTCCATTTTATGTTCAATAAGCTGCTTAATGGGAGAAACAACCTCACT
TAATATTTGTGGGTAACATTACAGCCCCCATTGTTTATATGAGAGATGACTGTTTTTCAT
GTTTTTCTTAATGAAACATGACATTTATATAAGAAATATATGTATATAAGTAAAATTCTT
CCAATAAGTTTTTTTTTTTTTACTTTATAGGCAAAAGGCAATTGTCCTTCCAAAAAGTAA
GAGTTTAATATACTGAGATCAAATCACTGATATTTCCATGGTATCTGCTAACACGTATAA
AATATGATGTTGAAGAGGGAACTTCCTAATTAATAATATGTCTGATATACTTGTGTACTC
CTCCACCTGCCTCCAAATTGCCTTCCACTAAAACAAACCATTAAAAACTTCCCATTCAAT
GTATACTTTTGTGGAAATGAAATAATCAATTCAATATCTACTTTTCTAGATCTCCCGTCC
TCACTGACATGCACAATATAAATGAGTTTTTACTGTTAGAACTTTGAGCACCAATTCATA
TTCTCATAAAAGAATTTCCATCTACTAATAAGAGCTCTTACTATTCACATTTTTAACAAC
AATAAACACAAACCCTCTTTGGGTTACTATCAATAATAAAGACGTGCATTGTGGTAAAAT
TTCCCTAGTTCACAACAGATATTTTCTTCTTGAACATCTGATTTTCAGAAGAACAATCCT
GTCCTGAATTCTTTGTAATTTTACAAGTTACTTCTTCTCTTTTCTTGGCGCATGGTTTTA
GTTTTCTAGTGTTTATTTATGGAGGATGCATTCCCTTGCGTCTCTATTATTTCGAGTTCC
CCGTCTCTGGTTCTAAGGTGCTGCCTGCCTAAAACACACCACTTCACTGAACACCTGGCT
TCTATATTCCTCTAAAATACAGATGTACAGTTGCTTTTTCTGGCATCTTGGGCAAGGTCC
CACAACACTTTTAGGGAAACCAAGATTGTCTATTTTGATAACTACTTTTGCCAAAATAGT
TCATTCTTCTCAAGCCTGGTTGAGGGGGTGGAGGGGACCTTTAGAAGTCATATGGGCATA
GCAGGTGGGGGAAAACTGACAAAAGACCAGGGCGAAAATCATCCTCTGTGCCCCTGAAGA
TCTTAGTTGAAAATGCTCTACTAACATCTCTCACCAGCAAAAAGCCTGGAACACAGTATT
TTTCACTTAGAAACTAAGATCACTACCTCTGATTTTGAGAGAGCAGCCCCTGGGCACTAC
CTGAGCAGGTAAGGGAGACCACTGCTCTAATGCTCATAACAGCTCTGAGATTTAATGAAT
CACAGACCCATCATCTCTTTCTAGGGCAACGTATTTTATTTTTGAGAAACAAAGTAAAGG
AGGCTTCCCTTACAAATGCTGGATTTCTGACAGCTAGTTTTCAGACTTTTCTTTCGCAAG
TTGATATCTAGTAACTCAGGATCACTGCCTGAAAATCGCTTCCAAAGGGTTCAAATTTGA
ATCAATGTAGAGGAGGTGGCACACAGCTGCTTGCTTTCATTAACTCTTACCTCTACCAGA
AACCAAGCAGCTATGATGCCCAATCACAATTTCTATGACCACTTTCTTATCTTGTCAACT
CTCTGAGAGTTCTGAGTAGCATTTCTCATTTCTTGCTTTTCAGTACCCACCCCTCGAACA
TACTTCCTCAGTGTACCTCAGCCTCCCATCAAGCAAAAAATCAAAATTCCAGTTTATGGC
AAGAGCAGAATAAATGCAGCAGTCTCCTCTTCTCCATCATTTTCTGACTTTTCCCAAGTT
ATCGTACCAGCACAATGCCTTCTACTCCCAAATCACAGCAAGATATTAATAACCCTTAGT
AGAAAGATTCCTTATTAGGTCACACAGAGTCATTATGGCTTAATAGCTGTCACCCTCCCA
AGCTAACCTGTGCAACAGGTGTGGAAAGTAAACTTAGAGGCTCACTTGGCAACCCCACAA
ATAGGGCTTCACAGCTCTCCCCCCAATGCTCCCAATGGCCTCTGGTCCCCAGCATATGAG
CCCCTGCCCCTGTAGACCTAGGGAGAAGCCCTTCTCAGCTCAGCTCACCTGTTTGTAGGC
ATCGAGGAGGAAGCTCTTCCAGACGCAGCGCAGTCCCTCTGAGGTCAGCATG
Chart Advanced