SelenoDB
Release 2.0
Chart Advanced
Transcript Report for SPT00000010_2.0
Identity
TranscriptIodothyronine deiodinase 2 (DIO2)
SpeciesHomo sapiens (Human)
Transcript IDSPT00000010
Transcript release2.0
External ID ENST00000556811.1 (Ensembl)
Gene SPG00000002_2.0
Annotation
Prediction method(s)
Curated external database annotation (GENCODE, 15) [Report annotation error]
OrientationForward (Reverse in the original sequence)
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Full length Spliced 5UTR CDS 3UTR
Forward Reverse  
SNP (Present-day Humans) SNP (Neandertals)
Sequence
>SPT00000010_2.0 # Transcript # Iodothyronine deiodinase 2 (DIO2) # Human 
CATGCTGACCTCAGAGGGACTGCGCTGCGTCTGGAAGAGCTTCCTCCTCGATGCCTACAA
ACAGGTGAGCTGAGCTGAGAAGGGCTTCTCCCTAGGTCTACAGGGGCAGGGGCTCATATG
CTGGGGACCAGAGGCCATTGGGAGCATTGGGGGGAGAGCTGTGAAGCCCTATTTGTGGGG
TTGCCAAGTGAGCCTCTAAGTTTACTTTCCACACCTGTTGCACAGGTTAGCTTGGGAGGG
TGACAGCTATTAAGCCATAATGACTCTGTGTGACCTAATAAGGAATCTTTCTACTAAGGG
TTATTAATATCTTGCTGTGATTTGGGAGTAGAAGGCATTGTGCTGGTACGATAACTTGGG
AAAAGTCAGAAAATGATGGAGAAGAGGAGACTGCTGCATTTATTCTGCTCTTGCCATAAA
CTGGAATTTTGATTTTTTGCTTGATGGGAGGCTGAGGTACACTGAGGAAGTATGTTCGAG
GGGTGGGTACTGAAAAGCAAGAAATGAGAAATGCTACTCAGAACTCTCAGAGAGTTGACA
AGATAAGAAAGTGGTCATAGAAATTGTGATTGGGCATCATAGCTGCTTGGTTTCTGGTAG
AGGTAAGAGTTAATGAAAGCAAGCAGCTGTGTGCCACCTCCTCTACATTGATTCAAATTT
GAACCCTTTGGAAGCGATTTTCAGGCAGTGATCCTGAGTTACTAGATATCAACTTGCGAA
AGAAAAGTCTGAAAACTAGCTGTCAGAAATCCAGCATTTGTAAGGGAAGCCTCCTTTACT
TTGTTTCTCAAAAATAAAATACGTTGCCCTAGAAAGAGATGATGGGTCTGTGATTCATTA
AATCTCAGAGCTGTTATGAGCATTAGAGCAGTGGTCTCCCTTACCTGCTCAGGTAGTGCC
CAGGGGCTGCTCTCTCAAAATCAGAGGTAGTGATCTTAGTTTCTAAGTGAAAAATACTGT
GTTCCAGGCTTTTTGCTGGTGAGAGATGTTAGTAGAGCATTTTCAACTAAGATCTTCAGG
GGCACAGAGGATGATTTTCGCCCTGGTCTTTTGTCAGTTTTCCCCCACCTGCTATGCCCA
TATGACTTCTAAAGGTCCCCTCCACCCCCTCAACCAGGCTTGAGAAGAATGAACTATTTT
GGCAAAAGTAGTTATCAAAATAGACAATCTTGGTTTCCCTAAAAGTGTTGTGGGACCTTG
CCCAAGATGCCAGAAAAAGCAACTGTACATCTGTATTTTAGAGGAATATAGAAGCCAGGT
GTTCAGTGAAGTGGTGTGTTTTAGGCAGGCAGCACCTTAGAACCAGAGACGGGGAACTCG
AAATAATAGAGACGCAAGGGAATGCATCCTCCATAAATAAACACTAGAAAACTAAAACCA
TGCGCCAAGAAAAGAGAAGAAGTAACTTGTAAAATTACAAAGAATTCAGGACAGGATTGT
TCTTCTGAAAATCAGATGTTCAAGAAGAAAATATCTGTTGTGAACTAGGGAAATTTTACC
ACAATGCACGTCTTTATTATTGATAGTAACCCAAAGAGGGTTTGTGTTTATTGTTGTTAA
AAATGTGAATAGTAAGAGCTCTTATTAGTAGATGGAAATTCTTTTATGAGAATATGAATT
GGTGCTCAAAGTTCTAACAGTAAAAACTCATTTATATTGTGCATGTCAGTGAGGACGGGA
GATCTAGAAAAGTAGATATTGAATTGATTATTTCATTTCCACAAAAGTATACATTGAATG
GGAAGTTTTTAATGGTTTGTTTTAGTGGAAGGCAATTTGGAGGCAGGTGGAGGAGTACAC
AAGTATATCAGACATATTATTAATTAGGAAGTTCCCTCTTCAACATCATATTTTATACGT
GTTAGCAGATACCATGGAAATATCAGTGATTTGATCTCAGTATATTAAACTCTTACTTTT
TGGAAGGACAATTGCCTTTTGCCTATAAAGTAAAAAAAAAAAAACTTATTGGAAGAATTT
TACTTATATACATATATTTCTTATATAAATGTCATGTTTCATTAAGAAAAACATGAAAAA
CAGTCATCTCTCATATAAACAATGGGGGCTGTAATGTTACCCACAAATATTAAGTGAGGT
TGTTTCTCCCATTAAGCAGCTTATTGAACATAAAATGGAAAAGCAAACAAATACGTCTTC
AATAAAGTTTATTGTTTTTTTCACCAATGTATAGTGTTCCATTATGTTGCAATATGTTGT
TATTCCTATTCTAGGAAATTGGGAAGGATGAGTGATTTGTTTTTTCTTTTTGCATATGGT
TTGTATATTCCTATTCTGTATTTCTTTGTCCCTGCCTACTGATTTGATTAGTGACCAAGT
TCACGACTGATGTTATTATGTTTGCTTTTGATGATTTATGTAATAGCTACCATGTGCAGA
AGCAACCCCAGGACCCACATATCCAGAAACAAGACTGGACTGGGTGTGTGATAAATGGAA
ACATTATGAACACAGCTGCAACTGAATGATGGTCTCTTTTCTGTCTTCAAGTATGGCAAG
GGTGGTGGTTTCTGTGGTGGCATTTGAGGGTCACTCAGAATCTCTCAACCAGGTTGAATC
ACTTCTCTGAATGCTCTTGTCATTTGTGCCACTGTCTTTGGGTGTAGTCATTTCCAGAGA
CGTTGTAAGAGGTTCTGTTTGAGATGGCATCACACTATTTCATAACCCTGACTTGCATTA
TTTTGAGGCTACCCATCCCCAGAAGTGAAGTTTTCCAGGATGAGAGGGGTGTGTGCTCAT
GTGATACAACTACACATGTGATTTACTGTTATTAATTCTCCTTGTTGCTGCATGTCAGAT
GCCTGGAAAGATATGTAGAGAAAGTGGAGTAAAAGTATTATCCCTGTGTTTTGCCTCCAC
AAGGGGCAACACAGAAATAAAGAAAGAACAAAATATTTTCTTTTCTTTTTTTTTTAAATA
AACCCTTTCTTAAAAGGTTGAAAGGGATTTGAATTAACTTTATGGAGAAGCCTTTAAAGA
TAATGTGAGTTTAGTAAGAGATGGATTCTGTGTACAATTTTGATTGAAAGGAAAGTCTAT
AGACACTGGTGAGAGACCCTGAGGTGAATAAAAGGTGTTTGTTATTTAAGTTTCTTTAGT
CAGCGTCATTGCATCTGAACAGTATATCCTTGTGCTGGCGCTCAGAGACTAAAAACATGC
AACCAATAAGCAAATTGCTCTGTCTGGGAGCCTGGCTCTTACCTAAATGAAGTGTAAAAG
TAAACACACAGTATAGATGCTGACAGGCAGTTTAGCTTCTGCACGGTTAATATTGCAGAG
GTACAGAAAACATATTCATTTGAACATATAATTTTGGTTTTGAAAGGGTCTCTTTAACAT
TCTCCTCCTCCTCTTCATTCACCTCAAGCCTTTGACACTAGTTTCCACAATGGAAAATGG
CCCTTTTAAGAGAGAAACAGTCCCAAAAGAACACAAAGCAGGCCACAGCCAGAGCTTGTC
CATCACTTGGATAAAACATTGGGGAATGATAGAGCTTAGAGCTACATTTTCAAGGTACAA
ATTAAAAAGAGAATAGCTAAAAGGGAATTGAGCTCAGAGGAAGGAGTACGTAGCCTATTC
TTCAACTCTGATTTATTTGGCCAATCTGAATATAAATGGTTAAATCTCTTCTTAATGATA
GTTTGGCCATGTTTCTAAGGACATTGATGTAGCCTGGTCATTATGTCAAAGAATTTGAAA
CTTCCTGATAGTTAATAAAGCCATTTTCAGGGCTTTGGATAGCAAGTAGTATGTGTGAAA
ATTCTGCTACCACACACCCACCCTTCATTTTTATAATTTGCTTTAGTTTCTGTTATGAGA
TTATGTGATATATTGTCCACAAGGCTTTCTCAGGCTGTGGAAAAGAAAAAGAAATAAAAT
CCCAAAACAAGAAACAAGGTTAGTAGTATATGCTGTATTTTCTGCTTCTACTTGATGAAT
GGTTCTTTTCTCCCCCTTGCCCTGCATTTCACAGTCCACATGCTAAAGCAGCATTTCCTT
TTTCCCCATGCACTGAACACTGAACATCATCAAGGGAATCAAATTTTTATATATGCTATA
TGTTTATGTTCATGTTCATATTTATAAAGATTTCCATTCCAACATTTGAACTTGGCCCGG
AGATGTCTTCTGTTGTAAAAATGCAAATCCTTTATTTACCTCCTTTGTTGGTGTTGTGTT
GATGTTGCTTGCAAAAACATAAGAGAGGACCACTGTAATAGTGCAGATGAGAGAGATAAA
AGTCAGCGATGACAATATCACATTTTACGTATGTCCTTTCTGATCCTTGCAAAATAAAGG
GACCCTTTGGGAACATCGGAACTTCAAGACCAATTAGTGGAAATGATGCTTCTTGTGTTT
GGGCATTAAATACTGGGCAGGGTTCTCTTTAGAGCGGCTAATGCTGGCAGGGAAAGAGGT
ACCGACCTAATTACTCTTCCGCAAGAGTAAAAAATGCCTTTTGAATGCCTCTTTGGCAAA
TATGTCTCATTAAGGACAAAAACCAAACACAAACCCTCTAAGAAGGAGAAATTAAGATGA
TAGGTAACTTGTGGCCAGACTTTCTGTGCCACTGTGGGAAATTAAAACAAAGTTTGGGAG
TACCAGGGGATAACTTGTTTTTGTTGAGCTTCTTTCCTGCAGCCTAAATGTTATTATGGG
ACCAACTTTATTTTCTTCATCATTTTGGCTCTGTGTCAAGGAATGCTTTGCTCGTGGGGA
GAGCAAAGAATCTTCCATCATCGAAGACAATGGTGATTCTCCCAGCCTGTCTCAGCAGGG
TGCATAACCCAGCAAACCAAGAAGTTCTCCATTTGAAACTCTGGTCTATTAGGAATTTAA
TTTTTATGGTGACCAAATGGGGAGATGAGAATGAACAGTAATATCCTTTTAGAATATTTT
CTTTTAGGTTAAAGGAAACTTCCATATCTAAAAAAAGTTTTTTTTCTTTATTTTAGCTAA
ATTGTCCTCCATCAGGTTTTAGCAAAGATGGACACATTTTATGACTAGTATATGAAGCTT
ATAAAAGCAGACTACTGGTCTACTCACATTTGGATTTATGGATGGTGGGTGTGTGTTTTT
CCTTCTTAGTTTTATTAATAATATTAATTTTATCTATGCATTTTCTCTTGCCTAGGCACC
TTCATGAATAAGCATATCCATTTATGACATTATAACATTCAGTAAGGGACCCTGGCTCCT
CAACAAAATAAAAATAATAGGCCACATTTGTTTTGTGCACTGACCAGATGAGACTGTCAA
GGACAGATCAATAACATTGAGTGCTGATTTTGGTAGTACTCTATGAGAGGGCCCCAGGAT
TCATATTTCTAAATTTATCTGCCTCAGTGAGCTTATCCGTCACCCAAATATGATTATGTT
CATTGCAGGTCAGGGTTATCATTAAGTGTAAAATTCTTCACTGACCTAGAATTATAACAA
CTAGCATTCATTCAATAAAATAAATACTTCCCAGTCTAACCCTAATCCTAACAAAATGCT
AAATCCCCCCCATAAAGAGCATTACGAATTTGGTAACTTTCCTAATTTTTTTATTTTAGA
CTGACAGTGTTGTACTTACTCTAAATTTCCCAAGGCAAATTAGTCTGTGTTTTGGAAAGA
ATTCTGCAGCTGAACTATACATTGTTTCTAAGAAGGAGAAGGTGCCTTAACTTTCCAAGA
AAATTTACTGCAGGTAATAAGAGAGTCCCCTGTGACTAAAGCAACAGATTAGATTATTCA
GTTGAATAATCAGACATAATGAAAGGATCAACAGGTCTGCTCGGATGAATCAGGGGGTTA
GAGGCGCATTTGTCAAGGCCACATAATTGTTCATGGGTTTCAAAAATGATTCCAAAATGC
AGATGAATGTTTTTACCTATCAAGAACCTACAAGTGTACAGGTTGCTTACTTAACAGGAA
GTCCCTACAACGGACTAATCTGAATGCATTTAGGTCTTCTTATCACGGTACGTTGAGGCA
CACAGTACACATGATATTGTTAAAACACCCCTTCTAGAATCATTACTATTATTTCAAATG
GGAAAGATCTAAAGAGAAGAGACTGCTACCCACTACCTAGATCTATAAAAAAAAAAGAAG
TACAAAAAGAACTCACGGCTTAAAAGGTTAATAATACCTTCAACATATCTTTAAATTTGA
TGTATATTTTCATGCCTTAAAGACTAGGGTAGTTCATATGAAAGAATCCAGCTAAATGTG
CTTATTAGATTTCTCCATCTAGTGTCATTTGCAAATTAATCAAGAAAGTTAGTATAAGTA
AAATAATTTTCTCTGTGGTGGTGACTAAAAAACAAATGTACTTACTTAAATCACACCAGC
AGCTTCCTTTCTGAGAAGGAAGATTATTACAGTAAGATTTCTCTTAGAACACTAATAATG
CTTATTTCAAACCTTCCCTGCTAGGATTTTTCAGAAGGGAGAGAAAGAACTTTAATTCTT
TCTCTACAGTTAAAATGAGTTATGCATTAACATTAGATAGAAGCTTCTGAATAAAAGCCC
TTGAGTGGGTTATATCAGTTTGGATTGTTACATCTTTAACAATTCACTTCGAAGTGACTT
CAATTAACAGTAGCATTATGTGTGGCTGTATGTATATGAGGGAAATAAGTCAACCCAGTT
GGAAGTATATTGTAATATTAAGGATAGTATATAAAAATCAATTGTACTGTCCCTAAATTG
TCCCTAATGTTATTGGCTTTGATTAAACCATTCTAAGGAAGATCCAATCGTATTAATTCA
AACTGAAGTAATTGGCTCTTTTATTGTTGCCTGCTTTTTATGATCAATTTACAGATTCAA
AGGCTGCAAACTTTCCTTCATTCTGTTCTCAACTATTTAAACCATGTGCAAAGGGAGCAC
ATGAAACAATTTTTATCTCTACTTCTTCTGCCCCAATATTTTATAATTCAGAGGAGCTTG
TTAACAAATTGTGGGGTAGAAAAGTACTTTTTAATGTGACTTCCTAGATAAAAAGAAGGA
AACAAGCACACATGGAAAATGAGAAATTGACTTAAAGTAGAATTCTGGAGTAACCATTTT
TGTTTTTTTGTCTGTTTTTATTTTTTTTTTAAATGGAAATTGTAAGATTGGAGTGGTAAG
AACCACCTTGTAAGCAGTGGCAGTAGAAGCCTCCAGGGAGGATGCCATATTGAGGAGAGT
GCAAAGCTTTGCTCAGGGCATTTAAAAAAACAAAAACAAACACAGAATTGCCCAAGAATG
ATGATGTTCTGTTTCACATGGTGGGGTAGCATCTGATAAGGACAACACACACCCATAGAG
TTACAGTGCACAAAGAGCTCTTTTTCTCATGTTGTCCTCCAGTTGCCATATGTGGAAGAC
AGGCATTATTATTTCCATTTTACAGGTGGGAAAGCTGAATCACTAAAGAGGTTAAGTGGA
AGTAACACTTCTTATAAGTGGTAGACCTCAGGTTTTCTAGATCTGGCCAAGAATAGAGCC
CACTGGTATCACTGGCCATTGGTTGAGATTAAATGACTTAGTATCATGCAAGAAAATGAA
GGTCCTGCCTGGTGTTTCAGAATTCAGAAAGAGGGACCATGTCCCAAGACCCTGATAATT
TGTCTTAAAGTAGACCATTTGCTTCTAATTTTTAAAATGAAGTCAATTAATCATTTGTTA
TAGAATGCATGTTAAGAATTGACAGCAAAATAAGGATAGTAAAGAATAACAGCCTTGGCT
TAATTTTAAAAAGAGTTAACTCCAGTGCCTTCAGTGATGAAAATAATTATCTTCAGTGAC
TATACAGAATGAAAAAGACTTTTATTGTCTTTTGGGCCATTCTTTACATTACCTGCCATC
ATGCCTCTTTACTCAAATCAATAAATGTTTACCAAATGCTCTGAAGGAAATACCACACTC
TATTAGAGCCAATTGTAACTATTTAATGTGAATTCAAGTGGCAATGTGTTTAATGTGATA
TTCTCACCTTCTTCTTCTTCTTCTTTTTTTTTTTTTTTACCGTCAGGTGAAATTGGGTGA
GGATGCCCCCAATTCCAGTGTGGTGCATGTCTCCAGTACAGAAGGAGGTGACAACAGTGG
CAATGGTACCCAGGAGAAGATAGCTGAGGGAGCCACATGCCACCTTCTTGACTTTGCCAG
CCCTGAGCGCCCACTAGTGGTCAACTTTGGCTCAGCCACTTGACCTCCTTTCACGAGCCA
GCTGCCAGCCTTCCGCAAACTGGTGGAAGAGTTCTCCTCAGTGGCTGACTTCCTGCTGGT
CTACATTGATGAGGCTCATCCATCAGATGGCTGGGCGATACCGGGGGACTCCTCTTTGTC
TTTTGAGGTGAAGAAGCACCAGAACCAGGAAGATCGATGTGCAGCAGCCCAGCAGCTTCT
GGAGCGTTTCTCCTTGCCGCCCCAGTGCCGAGTTGTGGCTGACCGCATGGACAATAACGC
CAACATAGCTTACGGGGTAGCCTTTGAACGTGTGTGCATTGTGCAGAGACAGAAAATTGC
TTATCTGGGAGGAAAGGGCCCCTTCTCCTACAACCTTCAAGAAGTCCGGCATTGGCTGGA
GAAGAATTTCAGCAAGAGATGAAAGAAAACTAGATTAGCTGGTTAAAGGTATGATTATAA
GAGAGCTTATTGTTTTAAAAAGTTATATAAAGGCAAGGAAATTAAGAACTGAATCCATAT
TTCAACAGAGCCCTATTGGCTTACTGAAAGACAGGAGTTTATCTATCGGAAGAACATGAA
TCTCTAACAGCTCCATACTTCTTTCACTACTCAAATGGCATTGGGCTGAGTA
Chart Advanced