SelenoDB
Release 2.0
Chart Advanced
Secis Report for SPS00001401_2.0
Identity
SecisSelenoprotein S (SELENOS)
SpeciesHomo sapiens ssp. Denisova (Denisovan)
Secis IDSPS00001401
Secis release2.0
External IDNone
Transcript SPT00003186_2.0
SPT00003187_2.0
SPT00003188_2.0
Annotation
Prediction method(s)
Thermodynamic pattern-based SECIS prediction (SECISearch, 3.0) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox Forward Reverse  
SNP (Present-day Humans) Fixed differences to present-day humans
Sequence
>SPS00001401_2.0 # SECIS # Selenoprotein S (SELENOS) # Denisovan 
CCATCAACTGTCCACATCAGTAATCCTCACTGGTGGGCTCACCATTGATAAGGAAGACAT
CATTCAACGCAACCTGTCAC
Chart Advanced