SelenoDB
Release 2.0
Chart Advanced
Secis Report for SPS00001250_2.0
Identity
SecisIodothyronine deiodinase 3b (DIO3b)
SpeciesTetraodon nigroviridis (Tetraodon)
Secis IDSPS00001250
Secis release2.0
External IDNone
Transcript SPT00002646_2.0
Annotation
Prediction method(s)
Thermodynamic pattern-based SECIS prediction (SECISearch, 3.0) [Report annotation error]
OrientationForward
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Sequence
>SPS00001250_2.0 # SECIS # Iodothyronine deiodinase 3b (DIO3b) # Tetraodon 
CTCAGTATTTCTGTGAGGTTCGGTCTTTAAACGGAGCAGATCCAGAGGACCGACACTGAT
GTTCCGATACTGCA
Chart Advanced