SelenoDB
Release 2.0
Chart Advanced
Secis Report for SPS00001199_2.0
Identity
SecisIodothyronine deiodinase 3a (DIO3a)
SpeciesTakifugu rubripes (Fugu)
Secis IDSPS00001199
Secis release2.0
External IDNone
Transcript SPT00002554_2.0
Annotation
Prediction method(s)
Thermodynamic pattern-based SECIS prediction (SECISearch, 3.0) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox Forward Reverse  
Sequence
>SPS00001199_2.0 # SECIS # Iodothyronine deiodinase 3a (DIO3a) # Fugu 
CCCGGTGTTGGAAACATCGGTGTCGGTTTTCTGGACTTTGCCCTTTAAAAACCGAACTTC
ACAAAAACACCGGG
Chart Advanced