SelenoDB
Release 2.0
Chart Advanced
Secis Report for SPS00001177_2.0
Identity
SecisIodothyronine deiodinase (DIO)
SpeciesTaeniopygia guttata (Zebra Finch)
Secis IDSPS00001177
Secis release2.0
External IDNone
Transcript SPT00002511_2.0
Annotation
Prediction method(s)
Thermodynamic pattern-based SECIS prediction (SECISearch, 3.0) [Report annotation error]
OrientationForward
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Sequence
>SPS00001177_2.0 # SECIS # Iodothyronine deiodinase  (DIO) # Zebra Finch 
TGAGTATTTGTTATGATGGTCCCAGCCTAAAGCACTGGTGGCTGTGACCTGATTCTAGAG
AATATTTA
Chart Advanced