SelenoDB
Release 2.0
Chart Advanced
Secis Report for SPS00001003_2.0
Identity
SecisIodothyronine deiodinase 1 (DIO1)
SpeciesPelodiscus sinensis (Softshell turtle)
Secis IDSPS00001003
Secis release2.0
External IDNone
Transcript SPT00002103_2.0
Annotation
Prediction method(s)
Thermodynamic pattern-based SECIS prediction (SECISearch, 3.0) [Report annotation error]
OrientationForward
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Sequence
>SPS00001003_2.0 # SECIS # Iodothyronine deiodinase 1 (DIO1) # Softshell turtle 
TTAATATTTGTTTATGACAGTCATAGCGTAAAGCACATGCAGCTGTGACCTGATTTGAGA
ACATATTTA
Chart Advanced