SelenoDB
Release 2.0
Chart Advanced
Secis Report for SPS00000923_2.0
Identity
Secis15 kDa selenoprotein (Sel15)
SpeciesOryzias latipes (Medaka)
Secis IDSPS00000923
Secis release2.0
External IDNone
Transcript SPT00001969_2.0
Annotation
Prediction method(s)
Thermodynamic pattern-based SECIS prediction (SECISearch, 3.0) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox Forward Reverse  
Sequence
>SPS00000923_2.0 # SECIS # 15 kDa selenoprotein (Sel15) # Medaka 
GAAAGGCACAAAGTAAACATCAGAGTTCACACTCCATCAGGGTTCTTGTGAAGTCTTCAC
ACATGTGTGCCCCTG
Chart Advanced