SelenoDB
Release 2.0
Chart Advanced
Secis Report for SPS00000800_2.0
Identity
SecisIodothyronine deiodinase (DIO)
SpeciesOchotona princeps (Pika)
Secis IDSPS00000800
Secis release2.0
External IDNone
Transcript SPT00001706_2.0
Annotation
Prediction method(s)
Thermodynamic pattern-based SECIS prediction (SECISearch, 3.0) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox Forward Reverse  
Sequence
>SPS00000800_2.0 # SECIS # Iodothyronine deiodinase  (DIO) # Pika 
ACGAATGTGACCATCTCCAACCACTGACTGAGCCGAGGACTCTTTCGTCAGGAGTTATCA
TTTGCACACTGGT
Chart Advanced