SelenoDB
Release 2.0
Chart Advanced
Secis Report for SPS00000750_2.0
Identity
SecisIodothyronine deiodinase (DIO)
SpeciesMyotis lucifugus (Microbat)
Secis IDSPS00000750
Secis release2.0
External IDNone
Transcript SPT00001595_2.0
Annotation
Prediction method(s)
Thermodynamic pattern-based SECIS prediction (SECISearch, 3.0) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox Forward Reverse  
Sequence
>SPS00000750_2.0 # SECIS # Iodothyronine deiodinase  (DIO) # Microbat 
GTCCCCCTGCAATTCAGAAGCAGCTCGTGGTCAAGACCAGTTAGAGGCAGCTCATCATCA
GCAGCGGGGC
Chart Advanced