SelenoDB
Release 2.0
Chart Advanced
Secis Report for SPS00000611_2.0
Identity
SecisIodothyronine deiodinase 1 (DIO1)
SpeciesMacaca mulatta (Macaque)
Secis IDSPS00000611
Secis release2.0
External IDNone
Transcript SPT00001308_2.0
Annotation
Prediction method(s)
Thermodynamic pattern-based SECIS prediction (SECISearch, 3.0) [Report annotation error]
OrientationForward
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Sequence
>SPS00000611_2.0 # SECIS # Iodothyronine deiodinase 1 (DIO1) # Macaque 
TACATATTTGTTTATGATGGCCACAGCCTAAAGTACACACGGCTGTGACTTGATTCAAAA
GAAAATGTTAT
Chart Advanced