SelenoDB
Release 2.0
Chart Advanced
Secis Report for SPS00000601_2.0
Identity
SecisSelenoprotein M (SELENOM)
SpeciesLoxodonta africana (Elephant)
Secis IDSPS00000601
Secis release2.0
External IDNone
Transcript SPT00001285_2.0
Annotation
Prediction method(s)
Thermodynamic pattern-based SECIS prediction (SECISearch, 3.0) [Report annotation error]
OrientationForward
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Sequence
>SPS00000601_2.0 # SECIS # Selenoprotein M (SELENOM) # Elephant 
CCCAGGGGCAAAATGAAGCGCTCAGCGTCCAAGGAAGCGTCTTCCTCGCTGAGGGCCGAC
ACCCCGTCCCTGGG
Chart Advanced