SelenoDB
Release 2.0
Chart Advanced
Secis Report for SPS00000600_2.0
Identity
SecisSelenoprotein I (SELENOI)
SpeciesLoxodonta africana (Elephant)
Secis IDSPS00000600
Secis release2.0
External IDNone
Transcript SPT00001284_2.0
Annotation
Prediction method(s)
Thermodynamic pattern-based SECIS prediction (SECISearch, 3.0) [Report annotation error]
OrientationForward
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Sequence
>SPS00000600_2.0 # SECIS # Selenoprotein I (SELENOI) # Elephant 
GAAGTTTGTGCTTGAATGAAGAGTGTATCTTAAACCCTTTTTTTTGGACAGGTTGCACTT
GGATAAAGTAGGCACCAC
Chart Advanced