SelenoDB
Release 2.0
Chart Advanced
Secis Report for SPS00000566_2.0
Identity
SecisIodothyronine deiodinase (DIO)
SpeciesLatimeria chalumnae (Coelacanth)
Secis IDSPS00000566
Secis release2.0
External IDNone
Transcript SPT00001218_2.0
Annotation
Prediction method(s)
Thermodynamic pattern-based SECIS prediction (SECISearch, 3.0) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox Forward Reverse  
Sequence
>SPS00000566_2.0 # SECIS # Iodothyronine deiodinase  (DIO) # Coelacanth 
CATATATTTCAATACATCTAGTCCCAGCAGCCAGAGGTTTGAACTATGACTTTCACTTAT
AAATATATG
Chart Advanced