SelenoDB
Release 2.0
Chart Advanced
Secis Report for SPS00000475_2.0
Identity
SecisIodothyronine deiodinase 1 (DIO1)
SpeciesGasterosteus aculeatus (Stickleback)
Secis IDSPS00000475
Secis release2.0
External IDNone
Transcript SPT00001059_2.0
Annotation
Prediction method(s)
Thermodynamic pattern-based SECIS prediction (SECISearch, 3.0) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox Forward Reverse  
Sequence
>SPS00000475_2.0 # SECIS # Iodothyronine deiodinase 1 (DIO1) # Stickleback 
CTGTCTCTCCGTTTCACTTCATCTGGCTACAGAAGCCGGTTAAACGGTTTAATCTGCAGC
CGTCACTCAGAAAGATTG
Chart Advanced