SelenoDB
Release 2.0
Chart Advanced
Secis Report for SPS00000280_2.0
Identity
SecisGlutathione peroxidase 1a (GPx1a)
SpeciesDanio rerio (Zebrafish)
Secis IDSPS00000280
Secis release2.0
External IDNone
Transcript SPT00000613_2.0
Annotation
Prediction method(s)
Thermodynamic pattern-based SECIS prediction (SECISearch, 3.0) [Report annotation error]
OrientationForward
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Sequence
>SPS00000280_2.0 # SECIS # Glutathione peroxidase 1a (GPx1a) # Zebrafish 
TTTGGACTTTTACTTCATGAAGATGCTCCTGTAAACATGCTTGTCTGTCGGGAGCAGCTG
ATGCCCTGCAAAAGTCCAGG
Chart Advanced