SelenoDB
Release 2.0
Chart Advanced
Promoter Report for SPR00003036_2.0
Identity
PromoterIodothyronine deiodinase 2 (DIO2)
SpeciesHomo sapiens neanderthalensis (Neandertal)
Promoter IDSPR00003036
Promoter release2.0
External IDNone
Transcript SPT00002971_2.0
Annotation
Prediction method(s)
Promoter prediction (5000bp upstream, N/A) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox Forward Reverse  
SNP (Neandertals) SNP (Present-day Humans) Fixed differences to present-day humans
Sequence
>SPR00003036_2.0 # Promoter # Iodothyronine deiodinase 2 (DIO2) # Neandertal 
AAGTTGTCTCCTCTTTCAAAGAAGCAGAAATGGCAAGACTAAGTCCAGTCTCTCCAGCCC
AGCAGTTGGAGTGTGCCCATCAATTCATTCAATTCGGAGCTGCTgCCtTttTTTTTTTTT
TTTTTTTTTTTtnaGgaTTtAAgAngTTnaAaAAAAAAAAAAAAAAAAAAAAAAAAAGCT
GGCGTACTCGTCCCTAATCCAGTTACCTCTGTCAGAGTCCGTTAAAGACAGGCAGTTCTA
CTTTCATTTCCAAGCACCTATGAGACTGTGGCAGAGATTTTAAAATTTTCTTTAGCCTTT
CATTGTCTCTATGCTCTTTAAACGTAGCCTGTTTCTTTCTTGAATTGCCAGAGTTTTTTT
TTTTTTTAAATGTGCTTTAAGGGTAGTTTTTTTTTTTTCTTTCTTTACTCCGTTTTACAC
ACACTTTCTGTGCTTCTCTTTCTCCCAGTCTCACTCTCTCCCTTCCCCAGGAGCGACTGA
CTCCTCTTTTTTCTCACTCTCTGTCTTTCCCTTCTTGCTATCTGTCTGTGGTGCAAAGTG
CCTCTCTCTGCAGCCCAGTGAGTCTCCCTGACGCCTTTTATACATTCCCTGGCTAATTGC
TGCAATAGAGAAGTGAAAGCCTAATCTTGGTAAAGATCTTGACGTCATTGAGAAAGAGGG
CTTTACTTTGGCCAGGATTGCAGTGAATAGAAAAGCAAAACTCGACAACTTTTTTTTTTT
AGAAGGGGTTGGGGAGAGACAGTGGAATTTTGCTTTGTGATTTAAAGAGAGAAAAAAACT
AATACCCTTGACAGCCTTCAGGAAATGCTTCCAAACTTTGGGAAAAGTAATTTAATATAA
TGTGCAGATTGATATGGCCAACACTCTCTCTTCTGATTATCATTATCATTAATTTATGAG
GGGTTTTGGAAAGAAAGGATCCTGGAAGGCAGGTAGAAAAAAGGAAGAGTTATCACAGGC
GGTCTTTGCTCTGTTTCTTGGAAAATATGAACATTTATATACAATCTTTATACCTTTATA
CCATGACTCCAACCCTTTGTAAGATCTGTGACCTAGGTCCTTTAAATTTTTTTGAGTCAT
TATCTTATTTAAGAAAATGCAAAATGAGTTGTAGGTGGAAAACTTGTAAACTATTTGAGT
ACCATCCCAGCATTTCTTTAAAGCTTCTTGCAGAAACTTGAATACAGGTTTCTTTTTAGT
TTTACCCAAGCTTCTAATGAAAAAAAAAAAAAAAATCCAAGTTCCTCCAGACAGGGAAGG
AGCTAGGCGACATTCTTTTAGCTTCATTTTGCAGATAAAATTAAAACTTTCCATTGAATA
GCATTAAGAAGCCATAAGGCTGAGAAATTATTAATGAAAGCTCTTTAAATTTGGTGTTTC
ACCTGCTTCTGTTAGCATAACCCCTAAGAGACCTGATACTTTAAGGAATCTTCCTTTTTG
TTTGAAAAAAATTTTAATTAAATGTATGGGAAGTTAAGAGCCGACTGAATTGGTTCAAGG
TGCCACATTGACCATTGTTCATTGGCTTGCCTCTCCCATGAGTCTTTAGGACAGGTATTT
AGGCAGACAATGCTTTGGCAGAATGGCATGACCCCCACTTTATTCTACTTTTTCATCCTG
TGTTACCTAATAGATCACTGAGTTTTCTCAGTGATAGATACTGAGTTTTAGATACTGGGT
AATAGATAGCTGAGTTTTCTATGTAGCCAGAGCTTAGGCATAAGCTAAGCAGTAGGTGCA
AGCTTGTGGTTAGCGTATTGCGTATTTTTTCCATGTGGCTAAAACCTTCATGATCACAGA
AATAATTTAAAAGCCTAGACAAGAGTCATTAATTTGTCGTCCTGTTAGCTGAATTCTGCA
TATTAATGCATTTTGTTTGGTTGGCAGGTTGCTTTTTTGCCTTTAAAAAAACAATAATCA
AAAAAGAATGCCTTTAGGTTCCGTGAGAGCAGGGATTCTTGTCCACTTTGTTCACTGCTA
CCTCCCCAACACCTAGAACCATGCTTGGCGCACAGTTGGCTCATTGAGGACGTCCTGAAT
GAATGAATGAACAGGGCATGTAGAGGGCCTCTGCATTGCTCTACACTAGGGGGCACCATT
CACATACAATATGATGTGAATGGGGGTGCCCTGGAATTGTAAAACGTGGTGGCCTTGTGC
AATGCCCTCTCTTGTGACACAACCCTCAGCATTCCCTACAAATTCTTTCATTTTTTTCAT
TAGTTTGGCTCCTAATGAGTTTTGAATTTGCATCTCATGGACGAAATTGTTAAAAGACTT
CAAAGCTTAGAAAAATAATATAAACCACATAGAAAAATTACACCTTCCCTATGACTAGCA
TACAATGTTAGCAAAATAATATTACTAATATATGCAATGTACATTTACTGCATGTATCTT
CTCAAACTACTCAATGTCCTTATGGGAAGAAAGAAAGAACAAAGGCAGGGAGTTGATAGC
ACAGTATTTTAACTGGTGGAGATGTGAAAGCTATATTGCCATAGTTCCCACCAACAATGG
CAGAAGGAGGTGTAGACTCAGGAAATGCTGCTTCCACTCAATTGCCCAGGCCTTAGAATC
TCTCCCCTTCTCAGACCTTCATTCTACCTTGATTGAATTAAACCAGTGCTCCCCTGCAGT
GGAGACTTCAGCAGCTTTAAACCAATTCTCTCTCACTTGCTTTTGCTCTGAAGGAGGAAA
GTATGTTTGTAAATGGCAAGCTAAGGAGAGGGATTGATAGAAAATCAGAAAAACCTTTCT
TTTAAATGTGAAGTTCAAAGCATATCCAGACTTTAAGTGGTTATAAGTTAGAATTAGGAC
TCTGTTGGGGGCTTTTGTTTCTTTTTATTTATTTATTTATTGAGGTTAGAAGTGTTTGAA
GGGAATTTTTTTTTAAATAGGAGAACAAAAAGATACACAGCCAATCTGGTTATGTCATTT
CTCAGATTTCTTCAATCATTTTTCTAAATGAACGATAAACACATCACAAAACTGAGGGCC
ATTCCTCTAGCAGATAGACAATCTGTCCATCCAAGAAATTACATTTCTCCAAAGCTATTT
CTTTTTTTATGCATGGTGCACAATTGCTCGTTCCAGTTATTAAGAATATTTACCACATTG
ATTTTCAAGTAATTTTATACTCATTAAGTAACAGAATAATCCTAAGGTGACAGAGTATGA
CTTTTCCCATCATATAGATGAGAGAAAGCAGATTACCAAAATTAGGGAGTCCAAGCGGGT
GTTGGGATATTTTCCCTAACTCTAAATAAGCCTCACTTTTTTTCTTTAATGTCTGTTATG
GGTCCTGGTCATTACTATGAGAACCAAAACCCTTGTTGAAAGTGGTTTGCTAGTAATTTA
ATCTTCAAAATGGCAAAGGCTGTGAGGACTTCACATCTGTTTAAGACTGTCCCGACTCAG
GCTCCTTGTTTAGATTTCATATGTTCTTTCAAAGGGCTTGGCTATCTTCTTGGTCATGTA
TGTGTTCTTAGCAATCAACATGTAATGAGTTAAATGCAAACCAACGAGGGGCATGTCGGT
TGCATTTCCCCATACGATATTCCACACGGGTTTTAAATTCCAAAGAGAAGCAGCCTAGGG
CAAAATGCTTTGGGCTTTTTATGAAAAAACCTTTGCAAAATTGTTTAACTTTTTTATATT
CCCATAGTAAAAGAGCATCATGTCCTACTGTTGCCTCTTTCTGGTTGGAAAATAACAAGC
ATATGAGTCACAAGACTTTCTTTAGTCCTCTTCTTGACTCTAAAATTGAGATTGAGAAAA
TAAAGTTGGATAATCTGAAAGCAGACTTGGAAATTTTAAGCACAACAGTTGCCACTACTA
TTTCCTTATTCTTATTTGAAAGAGCAGAAGAGCATCCAGACAGTTCTGTCATGTTAACAA
CTCATACCATGGACTTTCAAGCTGCCTTTGTTTCGTGGAATTTTATTCTTTCTAATTCCA
GTGATTTGTCAAGTGCATAATTTAAAAAATGGCATTTCATTTTTACTTTCTTAAAAACAT
GTCAAATAAACACATTATAAATCCAAAAATGTCTGGAAACAGCAGGCATGCTGATTTTGG
ATTTGAGAATATGGTTGCCATACATAACGCCTAAAACAGCGCCGCTCTTATCAGAGCAAG
GAATCACAAACTGTATAACCTACTGCCTCCAGTGACTCTGCCTGACAGGGAGTTATGACG
AACGGCTTACACCACAACTACTGAATCACTCAAAATTCCCTGTGGGCCCATCCATTCCAC
AAACACAGCCGTGTTCTCTGCCTTGTGATGAAAGGAGAAGCTCAATGGATAAAATACACA
ATCCCAGAGTAAACTCTGACACACCTTGAgCAAAGCAACTTGGGGGCGGGAGGGCAGGCT
GACGCCTTGGGAGGTATGAGCATTCTCTCCCAGCAGCCCTCTCCGTAGGTTCCTCTGCAG
TGCTGGCAGACAGCACCCATCCGAGTTGTTAATGCATTCTTCCCTCAGGAACTGTTGCTT
CTCTTTTTTTTCCAGGCTACCTACTGGTAAGACAGAGGGGGAGAAAAAGACAAAGGAAAT
AAAAAGGAGAGGGAAAGCAAAAATGAAGAGAAAAAGGGAGATAAAGATGGTAGGAGATAG
GCAGGGAAAGAAAAGATTCAATGAGTTGCCAGTGGAGGCCACCAACAAAGAGCCAGTTAA
TGCTAATTGTGGCGATGCTCTTTGTGAGGCAACAGCTGTCTGGTATCTGGATGAAAGCCA
CCACCGCATTTCACAGAGGCCACAGAACAGCTGTTAGGAGACAACAATATACTTCACTTA
GGATTGGCCTAGTCTGGATCCACATTGATAGCCAATCCCCTCTCCCCACTGCCCAAACCT
CTCCAGGTGCCTTGACTCTTATTTGGTTTTGAGAACAGTTTATCAGCCTCTAGAGACACC
CAGAGTTTGGGATGCTGTGGGAAGAGGGGTGGTAGGGGAATTGAGAAGAAGACTTTGTAA
AGTTATACATGGTGAATTCA
Chart Advanced