SelenoDB
Release 2.0
Chart Advanced
Promoter Report for SPR00002941_2.0
Identity
PromoterSelenoprotein M (SELENOM)
SpeciesXenopus tropicalis (Xenopus)
Promoter IDSPR00002941
Promoter release2.0
External IDNone
Transcript SPT00002876_2.0
Annotation
Prediction method(s)
Promoter prediction (5000bp upstream, N/A) [Report annotation error]
OrientationForward
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox
Sequence
>SPR00002941_2.0 # Promoter # Selenoprotein M (SELENOM) # Xenopus 
ATGCACACTATCAGCTTACAGGAGGCTTTATTTGGTAGTAAATCTTGTTTTATTGTGTTG
GGTTGAAAACCCCAACATACTGTCCTTCGACTTTGGCTTATTCTTCTGCTTCTTCTTCTT
CTTCTTAGCGCCCCCCATTTTCTAAACGCTACTCCTCCTACAGTTTTAGGGGTACAACAC
CCAAACTCTACACACTTCTTCGCCCTATAGTGGAGCAGGTTGCTTGTGCTTTTCTAAGCG
ATCCCGCCCCCCGTCTTTTTGTGGCGCCGCTCCGAACCCCCCAATTTTCCCATTGACTTT
GACAGGGAAGATTTTCAAACTGCTGCCACGCTTACAGCTTTAAAGCTACACTCAACAAAC
TTGAATAACATAATCATGGGGTCACCCCGAATGAAACAGCCACTTTGTTGGATGACCCCA
AAGTGGGAGGGGCCAACAACAGCCAATAAAATTTTATCCATTGACTTTAATGGGGAAATT
GAAACTGCTTTGAGGCTACAGTCCCCAAACTTGAATCACATAGTCATGGGGTCAGTCTGA
ATGAAAATATGATGATTGTTGGATGCCCAAAAGTGGGCGGAGCTGTGAACAGCCAATCAG
GTTTTACCTATTGACTTGGTGGAAATTCAGCCTGCTGCCATTCTCACAGTAACAACACCA
GGGTCCCCAAACTTTGCAGAGTTAGGCACCAGGTAACTGCGGTTCAAGGTTAGAAAAAGT
GGGCGGAGCTACCAACAGCCAATCAAATTTTACCTATTGACTTTCAATGGGGAAATTCAA
CCTGCTGCCATTCTCACAGTTTCAACCCCAGGGTCCCCATACTTTTCACAGTTGGTCACT
AGGGGACTGCAGTTTTAGTTTTGAAAAAGTGGACGGAGTCACCAACAGCCAATCAGATTT
CACCTATTGAATTTTATTTATTTTGATGCCAGGGTTCACAAACTTTGCACAGTCAGTCAC
TGGGTGACTAAGTTACAAGTTTAAAAAAGTGGGTGGGGCCAACAACAACCAGATTTCACC
TATAGAATTCATATGTTTAAATTTAAACTGCTGCCATTCATTAAATATTAATACTAAGGT
CCCCAAACTTTGCAGAGCTAGTCACCAGGTAACTGCGGTTCGGAGTTAGAAGTGGGTGGA
GCCACCAACAGCCAATCAGATTTTAAATATTGATTTTCAATGGGGAAATTCAACCTGCTG
CCATTCTTACAGTATTAGCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNAGTTATATAGTAAAAACCACTGTGCAAATTTTGGGGACCCTGTTTTTTT
TTTTTTTTTTGGGGACCCTGTTTTCAGATCAGATTTCAACCCAGCATGAAGTTTGTTCTC
AAACTTCCCTTTCTAGTTCAACCTAATCTTGCCACCAAGTCTGGAATTCAAAAATAATTA
CCTGGTTTGGGGGCACTGGGAGCAACATCCAAGGGGTCGGTGAGCATTATGTTGCTCACG
AGTAACTGGTTGGGGATCACTGCTTTAAAGCATACCAGGCCCTACCATCAAGAGTCTTTC
AAAAGCTTTTTCCATTCTTATTTGCCTTATGCAAATATTAACATACATATTTATATTCCT
CTCCTTTCTAACTCTTCTAAAGGTGCGTCCTAGCCTTGGCTGTGCAATAGTTCATATTCC
TCATCTCCTCTAACCCCCTTTAGCCAGCTTCCACATGTAAAAACCAAAAGGGCTTAAGGC
AATGGGCTACTGTTGGGGGGAGCATGGTTTTAGATCATTTGGCTGGATGTTATTAAACCA
TATTGGTACCTTAAAATAAACCATTTGAAATAAGGTTGATGTGAAGCACCAAAAACCATC
ACTGCCATCTCTTACTGCTATAGTTGTAATGGTTACAATTATAGCAGTAACATAATCCTC
AGAGGATATCATAGACAACCTTATACTAGCAGTATGGTACTGCTAATACAAGTTTGTCTA
AAATATTCTCTGAGGATTTTGTTAAAATGTTGAGCTCTTTTTAATTGATTAGTTTGCTAA
CCTGAGCTTGGAGATAAGATGGATGGCCTGAATAACAGGTTATCCATCTTATCACTGCTT
AGAAGATTACCCCCCTTGGGGACACACTGCTCACAGTTCAAGCAGCCTTTTTATCATTTC
TGGATTGTAACATCCTTTTTAGCCTTAAAGGGCACCTAACACGCTAAAATTGCTTCAACC
ACCAGAGGTGCAAATGCAAGCATATGTGCAGGAAGCAATGGACACAGTTTCAAGCATGTA
TTTTGGTGTATTATCAGTAAATTTGTTCAGGCATGGCTATCCCAGATACTGGGATCTGAA
TGTGGTTGTGCAATAAATCTGTTGGCCTATCTTTCAAAAGCTTTATAGATGTTTTTATAT
AGCAACACTTTAAATGTCCAGGGTACCTTGACAACACTGAGGGGCCCGTTTCCATTTATC
AAAACATTCTTGTTTGTCAAAGCTGATAGAGTATCCAAATGTGCTTGACTGCTTTTAGCA
GTTTATATGGGGTATTAGTGCTCAAGCATGAGCAGGTCAGCAGCAGCAGGCACGAGCACT
AATACCCATTAAAATAATAAATCTCCTGTACAAATTGCATGTGCAGATTAATAACGCCAT
ACTAGAACAAACTGATCCAGTGCAGAAAATAATAAACTGTTACATTGAAAAGGATTGGTA
TTATTTTACATGCATCGGTACTGCTTGCAGAAAAGAATAAGGCTGATGGTAAATTAGGCT
CTTCATGTATTTAAACAGTAACCCATTAACAATGGATTTTTCCTGAGTGCCCTGGGCACT
GCTAAGTAATTTAAGCAAGGTGGCTTGAGTAGCTACTACCTAACTGGTTCAGCCAAATGA
AATTGTGTCTGCACTGCCAAAGGAAAGTATAATTGCTCACAGGAGAATATTAAAGGAACA
GTAACACCAAAAAATGAAAGTGTTTTAAAGTAATTAAAATATAATGTACAGTTGCCCTGC
GCTGGTAAAACTGGTAAGTTTGCAACAGAAATGCTACTATAGTTTATATAAATGAGCTGC
TATGTCAACATGGGGGCAGCCATTGAAGCTGGGAAAAAGGAGAAAAGGCACAGGCACATA
GCAGATAACAGATAAGCTTTGTAGAATATAATGAGGTTTTATCTGTTATCTGCTAAGTAA
CCTGTGCCTTTTCTCCTGTAAATGGCTGCCCCCGTGGCTACACAGAAGCTTTATTATATA
AACTATAGTAGTCTTTCTAAGGAAAACACAGCCGTTCTACCAGTACAGGGCAGCATTACA
TTATATAGTAATTACTTTTATATACTTTCATTTTTTGGTGTTACTGTCCCTTTAAGCAAG
ACCTAGCGTTATAAGAGGTACATCAACTGAATGACAAGCACTTACCACTTAGCACAGGTT
GTTAATAACACATTTGCCTTATGTATTTTCTGTTCTTTGTGGCATGGCAACTTTAAAATG
TATTAATAAACAATTTCCAATACATAAAAAATAATGTAAAAAATGGAAATTTGAGATGCT
AGCACTCATTTGACCTGTTCCATTTCAGGGTCTTTGGGACTTGAAGCAGAAATGTATACT
CCATGGCACCACTACAATGAAACTTTCATGCTGGCACTGTAGATTCTATGCTAGGTGGCA
TAGAAAGGGTTTGTTCAGAAAACATTTGCTTGGCTGTATGATACAATCATGTGTTAGGGC
CACTCAGTACCACCTCCTTTGATGATGCACCCAGTGGTGCAAAACGTGTCAGGGGGAAGT
GGCTACTGTGAGGGGGGAAGTCACTGCCTTGTGGTATGTTAAATCTGAAGGGTTTATAAG
TTGTTTTTATATGATTTGCTGTGAAGTTGTGCACTAACTTACACTTTAAAGGAACAATAA
CACCAAAAAATGAAATAGTAAATTAAATATAATGTACTGTTGCCCTGCACTGGTAAAAGT
TGTGTTTTTGCTACAGTAACACTACTATAATTTATATAATAAGCTGCTGTGTAGCCACGG
GGGCAGCCATTCAAGCTGGAAAAAAGGAGAAAAGGCACAGGTTACATAGCAGATAACAGA
TAAGCTCTGTAGAATACAATAGTGTTTTATCTGTTATCTGCTAAGTGCCTGTGCCTTTTC
TCCTTATCAATTTATTTGATATTTTGCTATTTGCTGCAGGACCCAGTGCAAGAAACATAT
GGCTGTCTTTTTTGTACCACTCTGCCAATACAAATTTTTCAAACAAAGTAACATTTTTCC
TGAGCTTTGCAACACCACAGGGCTGTAGTTATTTGAAGGATGTAAACAGCAGAGCCAGGG
CAGATGGGTTTGCAGGTTTTGGAATATAGCATATGGCATGGTATGATATGATAATTACCT
TATGTTATTATGTGCTACATTTATTTCATGGTGGCCATTAAGCACACTGCAGGTTCAGCT
GCTTCCTTAGTTTCATCTTGTGGCTATACACTGAGCCATGTGCTTACTGGAGTTATTCTC
ATAACGTGCACTCTCTCTCTTCACCTCTTGTATCGGTTATTTGTTGCTTTATATGTTACT
CTGTATGCCCAATGTATGTAACCCACTTATTGTACATTACATAATAATAATATCGCAGTG
TGCTTTACTGCAGCATCTTATTCTGAAGCCGAAGGCATATATAAATCACGGGAAAAAGAA
CACCGTCCACTGTGCCCTGATGGTTACCAAGCCGCACTGGCCCATACCGTAGGGTACCCA
CATGTGTCTGATGGCGGAGGAGGAGGGGCGCGGTATGAGGTGAATGCAATTCACCGTGGG
AGACAGAGCCCTATACTTGAGTAACACAATATCTATACTTTCTAGTTTTTCTTTGGGAAT
CCATCCGGCCCCAGAGAGATGAGCTGATCCCTCCCCCCGATGCTCCCTCCTCACTGACGT
GGCGCACACACACTTGCCCAGAGAGGCGCCTTCATATTCCAGCTGGCAGCCCGGGCTCCT
CATACACAGCTGGCACCCTC
Chart Advanced