SelenoDB
Release 2.0
Chart Advanced
Promoter Report for SPR00002573_2.0
Identity
PromoterIodothyronine deiodinase 2 (DIO2)
SpeciesTaeniopygia guttata (Zebra Finch)
Promoter IDSPR00002573
Promoter release2.0
External IDNone
Transcript SPT00002508_2.0
Annotation
Prediction method(s)
Promoter prediction (5000bp upstream, N/A) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox Forward Reverse  
Sequence
>SPR00002573_2.0 # Promoter # Iodothyronine deiodinase 2 (DIO2) # Zebra Finch 
TCTTCCTTGCTGTTTCGCTTCAGCCGGATACCTTCAGCTCTCTTTATTGCTCTGTACCCT
CATTTAAAAGAGTAAAGCAAAAGGCATTTCAAAAGCCTCATTACCCCTTTCATAGCTGCT
CTATTTAAAATAAGCAGAGATAGTTAAGTATGAGCAGGCTGCTTAAAAACATAACTGCAC
GATAGTCATTCAAGTGCAAGCTGCTTATTTTTCAGAAATTTAGATGTTAACAAAAATTCT
TCTCTTAACCAGGAGACCTGATTTTGCTGAAGAGAGAGGCAGCTGTTTTTCCAGTTCCCT
GCAGTTACAAAATTTAAGCTGAGACTGTTAATTGTTAACTTTCCTGCACTATCCCATTGT
TTCTCCGATATTTAAGCACTGATCAGATCTCACATTTCTGTGTCAGTAAAGCTAGCTACT
AGGGGAACATACTTAAAAAAAAAAAAAAAGGGTTATGTACATGACTTTCTGTCCTCCCTT
CCCTGCTTCCCCTCCTCTCTTTCCCTCTCTGCCTTCCCCCNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNCCCCCTCCCCCCCTCTACTCCGGTCTTTGTATTCCTGCCT
TCCTCCTCTCGCACTCTCTGCTATCTGCCTATGGTGCAAAGTGCTCTCTCCTCTGGAGTC
CTAGCTTGCTTCCCTGAAGCCTTTTATACATTCCCTAGCTAATTGCTGCAATAGAGAAAT
GAAACCCTAATCTTAGCAAAGATCTTGACGTCAATGTAAAAGAGGGCTTTACTTTGGCCA
GGACTGCAGTGAATAGAAAAAATGAAATTCTCAAAACTTTTTTTTTTTTTTCCCTTAAGA
GAGAGGAGAGAAAAAGAGAGACAGAGCAAGGGTGGAACTTTGCTTTGAAAAGGAGAAAGA
AAAAACCAAATATGCTTCTGAATGTTCTTGCAAATTTTGGAACAAGTATTTTCATGTAAC
ATGGAAGGTGACACAGCAACACAGACTTCTGTTATCAACAGGTTTTTTTCTCCTGGTTGG
ATTTTTTTTTTTTTCTTTATCCTTTTTTTTTTTCTTTGATAGGAAGGTCCTCTGAGTTGA
TGCATCCTAAGAAAGGGCATATTTCTGTAACATTTTTCTCCCACCTGCCTGAAGTACATG
TTTAGTGTTTAAATACCTTTTGTTGTTTTCTTGGTAATGTAAGTGAACACCTATAACTGA
CTTCATCTACTGATGTGTAAGAGAAGGAGATAAGAAAGAGATAAAATAAGTTTTTTATGG
ATTTGTGTTTTTGAAGCTAAAGTTCCCTGCCTAAAAAAATATATGCTTCAGCCTTAAATG
CTTTTAAATCAACTGAGCTTCAAGGACTTTAATATTCCTATTTAATATTAGGGTAACAAG
CTTTTGGTTAAAAGCTTGTAAGAAAAAATAGAAGTTTCCTATGGCAGAGCCATTGGTACT
TTAACAACTGCAAGGATCCCCTTCAGCCCCATGCTGAAGGTTTTTTGTTCATTTGCACTT
CTCTTTGTTTCACCATTTTAGTCCAACACTTAGTCCTCTTCTCACATGATTTTTTGGGGA
GCTACAGTAGACAAGTTTGTTTGGGGTTTTTTTAGCATGGTTCTAAATCCCTTAGGTAAA
ATTTCACTAATTTCCTGTTGCAGATATCCATAAGTCTGGGTTTTAGTGGATGTCTTCACT
ATATGCTTACTAGGCTCTCCTCACCAGATACATTTCATTCCCAGAGATGCCAGCATGATA
TCTAGTCTCTGTCAACTCACATCCTTGATGAGGAGCACAAACTTACTTCATTAATATATC
TTAGTCTTCATCAGTCATCACTGTCCCTTCTCTGCTAGCAAATGCGGAAGGTAAACACCA
TCTTCCTTACTCTGGGGTCTTTAATTTTCAGACATTGTAATATCACCTGGCCTGTCATTA
TACTAGGATGTACACTTCTAGAAAAGCCACCCCATGTCTTGTCTTGTTCTCACCAAAGAA
AAGTTTGTTTAGGTAGCTTAACTTCAGGCATTCTCAAAAGATATCACTCAGACAGGATAT
CTTCCAGCAAATGTTTACTCATAGAAAAAACTTTAAAAGGTTACACACATTAAACCAGTG
ACCTTCTGCATTACTAGCATAAACAAACAAACAAACATAAAAAAGACAGAATTTCTTTTT
CAAACTACTTTTTAAGTCAAATGTTGGTGATGACATTTTTCTGTTGCCATAGAAGGATTG
CAGCCTCACAGATCTGGCTTTATTACTAAAACTTGCAAAAACACGTTATAAGAAGGCATT
TATATATCCCCACACATGGATGAGTCAGTGTGCTCATGTTATGTGAGCACAAGACAGGAA
CAAGGGTCCCCAGAGCTGCTAAACTTGCTTACTGTCTGACCTCGGGCAAGCATATGTAAT
CACTTGATTACAAGCACTCTTAAGCCTAAGCTACTCCTCTGTAGATTCACCACTAAAAAA
TACATGATTCTGTCTGGGAAGGTCCCCTTTCTTTATTTTGGGAAGGTCTGTTAAACGGCA
GGCCTGGAGATTGCTGATGACAGTGCCAGATGAATCATCAGCCATTGTTTCTGAGAACAG
TTTGCAAACAGCTCTGAGGACAGTCCAGCTCAGGCTCTTCCTGTTCCCTGGAGGTAAAGC
CAGGCAAGACCTTACCCTGGGAACAAAATGTATTCTGGGTTCCTGTGAAACAACTGCCCC
TACCCACAGCATGCTTCATGGGTGAAGAGGTTGTTTGTAAGACAGCTGGAGACCAGACAG
CTACAGGGCTTTGAAGTGTATTGGGAACTGAGCACGAAGCCCATGGAGCACTGGTGGGAG
ATGGTATCTCCTATTTACTAAGTCACCTCTCTTGCCTATAAAGCTGACTGTGTGGATAGA
GTTAAACAGAACTGCAACAGATTGTATTTGGGAGTGTGAGATTGTGTTTTGTGTTTGTGT
CAGTCAAAAAATGGATGATAACTCCCTAACAGAACCATAAAGTCATAAATCTTTTGAGCA
AATAAATGTAAAAATCTAGTTTTTCTCATTACTGCCTTCAGAGGAGCCCGTCTCTGCAGG
CCACAATGTGCTTCTAGTCAGCTTGACAGTAGAGTCCAGTGGCCCTCAACAGGGATGGAA
AGCTTAACCCTACTTCTTGTAGTTTCAGTCAAGAAGTTTCTCCTTGACTGAACCAACTGA
TCCCTGTGTTTATTTTAGACATCAAAAATACAAGGGAAATCACTATCTGCATCTTTTGTG
AAATACAGATATGTAGAGCATAGTCTCACTTTTGAAGCCAAGAGTCTGTTGCTATTTTCC
TGCAGATGGTCATGAGACAAGAAAGAAAGGCTAGATGTTTCAGATGTTGAGATATTAAGA
GAGCCTTGAAGCCTTCCTTCTTGAAGGAAAACTGGATGAATTTGATACACGAGGAAGAAT
TAGGCAGAATTGAATTTACTCATGAAAGAACTGAAATAGGGTTCAGCTAAAGCTCATTTC
AGTTACCTGCTCTGCCATACCTTCCTATATAATTTGGGCATAGCCCTACAATGTACCTCA
GTTCTTCATCAGCAAAAGAAAATAAAAGTCCTCTCGTAATCTAAGGAGCAGTCAGGTTCA
GTAATGGGAAATTAAACATATCATCCATAATTTGTCAAGGTGGAATGAGCAAAGCCAACA
ACATTAAAGCATTTACTGTTACTAAAGCTTGTATGTGGCTAAAGTCAACAGTATCGGTAT
AGATGTTCATATTCTGTAATGTTTATAAAAATCAGTGCCATCAAAACCAAAACCGTGCAT
AGCATCATGTTTCTTTCCAGTTTCAACCCCAGTAGCATGAAGATTAGGACATGAGTCTCT
AGTAAGTTTGCTTAACTGCAACTCTCTTGATAACTGTAACTGGACACATAAAATTTGAGG
TGGAGTTACTACAGCCCAAGCCACTTCTACTCTCATTTTATAGTGCATGCATACTGGCTT
TCTGCATGTCAGAGAGTGTGTTTTACACAGTTTTTTGTGTAGGTTTTTTGTTGCTTAATT
ACCTGTGTAAGCTACTGTGGCACTCAATCACACTGTTTTTCAAGACTTAGTAGACTGATT
GATATTTTAATTACTCAGCCTTTATTTTCTGTAAGCAAGACTATTTTGAATACTCTTACT
CCTTGCAGCACAGCTGTGAAAGGCAAGCAAGTGACAGGCAAGCAAGGCTGCTGCTCTCAT
CCTACCCCCAGGAGGTTCATGGGAGAGACCATCCCAAAGGATTCAGTACAACCTGTATGC
CTCTCTTGCTGCTTCTCACTGCTTTCACTGCCAAAACCAAAGAATGAAGCTTTTTGTTTC
AGAGCTAGTTAGTGTGTCCATGAGCTTATCCCTGGAGAATTGTGCAGCTGCAGAGTGATA
CAGCTAGAGATGGGGAAGAGAAAAGTTTAGCTTAGCCTTGCCGCCCTGGGCAAAATTTGT
TTATTAAAGCCAAACAAGAATTTGTACCTTTCATAAACCCTTTTTTTTTTCTCTTTGCCA
AAAGATAAAAAATCATCCCTATCTCTCAGCAACAATTCCCTCACTTAAAATGCCATTGAG
CATTCACTGTCTATTTATACTTTTTGATCAGGATCAGCAGCATATTTTCTTTCTATATTT
AATGAAAAAAGAATTCTATTTTTTTGCACAGTTGCATTGTTATGTGAATGGATTATCCAT
GGTGTGGATCTCCAGGCCTTACCTTCCTCCATCACTCCTGGCCGCATCACCTCATCCGAA
CTGAGCACCGTGCCCAGCCTCATTCTGCCTGCTTAAAGCTTCCTCTGCTCTACAGGAATT
TGCCTACCAGCATCTCCAATGTGAGCACACCAAATCTATCCTTACTGCTTAATTTATTTA
CCTTTTGTATAAGCCTTGATTTTGTTTTATTTGGGTCATTCTACCATTGCTATTATGCTG
CATAATTGAGAGTTGATTAT
Chart Advanced