SelenoDB
Release 2.0
Chart Advanced
Promoter Report for SPR00002568_2.0
Identity
PromoterThioredoxin reductase (TXNRD)
SpeciesSus scrofa (Pig)
Promoter IDSPR00002568
Promoter release2.0
External IDNone
Transcript SPT00002503_2.0
Annotation
Prediction method(s)
Promoter prediction (5000bp upstream, N/A) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox Forward Reverse  
Sequence
>SPR00002568_2.0 # Promoter # Thioredoxin reductase (TXNRD) # Pig 
ACGTCTGCGCCCGCGAGGGCGGCGGCGGCGGCGGCGGCGGCGGAGATGGCTGTGCCAGGG
CCGCGGTTTAACTCCCCGTCGGACTCCGCCTGACAAGCGACCACACTCAGGCTCCCGCGG
CGACTGGGGTTACGGAGCTCGCCCCGCCCCTGGATCCGCCCCGGATCCATCCCGCCCCGC
CCCCGGATCCCCCCATTCGCCCCGCCCCGCCCCTGGCTCCGCCCCACCCCCAGCGCATGC
GATCTAGGCCAATGCCCGGACGCCCAACGGACTCGCCTGCTTTTAGCAAAGGGGCGTGTG
CTAAGCTGCATGGTGTTGTTATCCCAAAGTGGTGTACCTACAGTGGGACTACCTGGACTC
CTTTTGGTCTCCCAGGGATGCCCCATGTGGAGGACTTACTTCCACTCATCATAATCTCCA
GCAGCCTGCTCAGATCACCTTGAAAATAGGTAATGGTGATGGAAAATTTTTAAAAAATTA
AAAAAATAGATATGGTGGAATTCCCATTGTGGCTCAGTGGGTTAAGAAGCCGACTAGTTT
CCTTGAGGATTTGGGTTCAATCCCTGGCCTGGTGTTAGGCAAGCGGCTATGTAGTTCATA
GATGCCCCTGGATCCCATGCTGCTGTTGTGGAGTCTGTGGTGTAAGCCGGAAGCTGCAGC
TCCAATTCCATCCCTAGCCTGGGAACTTCCATATGCCGCAGGTGGGGCCCTAAAAAGAAA
AAAGGGAAATAAAAATACATAAATAAAACCATCGTTAAGAAGGATGGCTATTTTTTTTTA
AGCTTATATCCCTGAAAATAAGAACAGCTCTGTTTATCACTATGCATTTTTAAAATGAAT
TTCCTAGGTTGCTACCCCTCAGTCCCTACTGCATAGAATTCTGGAGGCACTCCCCCCCAC
CGGCCCCAAAATTTAAGGCCGCACTAGGTGCATATGGAAGTTTCCAGAGTACAGGTTGAA
TGGGAACTGCAGCTGCCAGCCTACATCACAGCCACACTGGATCCTTAACCCGCTGAGTGG
GGCTAGGGATTGAACCTGCATCTTCATGGATACTTTCCTTACCACTAAGCCACAAGGGGA
ACTTCCTGGAGGCACTTCTAATAAAAGGAAGTCATCTCTGCCAGAACAGGAATCCTGTAT
CCATCATTTGGGTGGGTGGGTGGAGGATCTCAGCGCTAACTTGCTGACTGTGATTAACAG
CCCCCTACAGCTGTGAGGAACTAATGAAACTGCAATAGACTGAGATCCTCAACCACAAAA
CCAGCAGGCATGGTCTGGTCCCTCTTGTGGGTCATCTCTTGACACCTCCCTCAGATTCCC
TGTGCTTCTCCACATGGGCTTTCTCCCTGTGCCTCAGGTGTGTCAAACCCATTCCTGCCT
TAAGGTCTTTGCATTTTCTGTTTACTCAGCCTAGATGTTCTTCCCTGTCTAGAAAATCTA
GCTTTTTCTTATCAACCAGGCTTGGCTTAAATGTTACTTTTTGTGAAGTAACAAAATAAA
ACAATTTAATAACAAATGTGATGTCCTTTAGTCAAGGGAAGTGTTTGTAGATTGGAAGTA
TGCAGTGCCTCACATGCAGTGATGCATTCTTCCAGACAGATGTTCGGGCAAGACTGAGTT
TCACAAACCGTTAGAAGCAGCAACATGGTCATGCTGGGGTTGCATATCTGATCTTAGAAG
GATCAAGGAACAAGGAAATAAGTATAGAGCCCAGAGTTGCCTTGGAATTTGGGGATTTCC
TGACTTGATAGGCTATTTCTGGTCAAGAGGAGCATTTACAGGAAGACAAAAGTTCAGTTT
GCTGCTGGGGCACCATGGCCAGGAGCAGCTCTATCTTGGGTCTAGAAATTTATTTCAATA
TTTCTTAAAGAACGTTTTGCTCTCTATCCAAAACGAAGTAGTCACCAGCTTCTATCGAAT
TGTATGTATTCTAGTTCCTTCATGACACAGTTATTGCTATTTGCAATTATCTTCTATAAA
TACTGGTTTACTTGTTTATTACCCGTGCTCCCCTCCCCCATCACCAACAAAAGAATGTGA
GGAAAGGTCCTCTTCACTCTATTCACAGCTCTGTCTTCAGCGTCTGTCACTCACGGTGTC
TGGCTCTTAGTAGGCACACAGTATATTTTTACTGAATGAGTGAGCAATTCAGACACATCA
CAAATGAAGCATGTAAATGACCCTAATTTGCTTTCCCTCTTATCCCTTCATTGTGTAAGC
CAGCTTGAACTGTGGTTTTTATTGCTTGCAATGAAAAGTATCTTAACAAATAAAAATATT
TCAGGGTTATGATGTTAGGTGCAGAAAAATTCATGACTCATACTTTCTTAATAGAGTACA
AATTTTTTAAACATAAAATATCCTTTTTTGTCCTTGTTACTTCTTCGGCCCTTAAATTCT
ATTTTTCCAAATATCACTGTGGCCAAAACTACTTTCTTTTGATATTTGTATACATATTTT
CCATTCTTTTATTTTCAACATATATTTGTCTTTTTTTCCCACTGATCTCTTGGGGCGGGA
TATAACCTCATTAATAATCACCTCTTATCCCTTATAAGTTCTTAATTAACTGAAGACAGA
TTCAAGAAATCAGATGATAGGGCCAAGAAAGTAGATTAGTGGTTGCCTTGGGCTGAGGAG
CAGGGGAGAAAATGGAGAAGCTGGGGAATGGGGGATAAGGGTCACAGGATTTATTTTGAG
GATGAAAATGTTTAAAATTTCTGGTGATTGAGGCACAACCCTGTGAATATACTAAAAGTT
TTTGAATTCATAAGACTTTCATACTTTAAATTCATACCTTCAATGGGTGCACTGAATGCC
ATGTGAATTATAATTTAAATAGTTGTTAAAGAAAGAAAATATTAATAAAATGATTAGAAA
ACTATAAAATAGAACTCTGAGATATGTGAAGTATTGTTGCCAAAACATATTTATATATAA
AATACTATATATAACATAAATTATTATATACAAATATTATATATAATTATTGTACTTAAT
ACTATATAATTAACACTATAAATATATTTCTATGTATACACACATGTGTCTATGAATAAG
AAAATTTCCTGAAATATGGCACAATAGGTAAAGAGGCAGAAAATATGATAGATAATAAAC
CAAAAAATCAGTCCATGAGGTTGAAATGTCTGTCGAGTAGGAGTGTCAAAAATACAGAAG
AAAAGGGATAAAAATAGGAATATAATAGTAATAGCAGGAGACAATGTCCCAGAACTGAAT
CGTGTGAGACTTCGGTCCAGAATGGCCCTCCAATGGATCAAAAAGAATCATCTGTCAACA
GCACAAAATTTCAGAATATCATGAGTAATAGAAATATCGTATGAGCTTCCAAAAAAGGTG
GGTGCAGGGAGGTGTATTTGGCAACACTAGGTGCTAGGAGGAAAAGGAACGTGGCCCCTA
AATTTGAGAGGAACATTAATTTTGGACAAAGACCTCTAAACAAGCCAATGTTTAAAGGCA
AAATAAAGATGTTTTAGACTTGGAAGGACTCATGAAGTCGACCTTGCAGAGAGCACTTCT
CAGAACATTATCTGAGGCTTCCCTCCCTCACAAATGAGTTGCTGATCCTTGAGAAAATGC
TCCAGGAGGACAAGGAGAGTCCATCCTAGGAGGTTAGTGAAAGGAAGCTTTGCGTGAAGC
CAGCCAGTCGTCTTACAGAGCTGACATCTTTCAAAGAGAAAGACGTCTCTTTGACATGGT
TCGGTTCAAAGAGAAGGAGGAAATGTCCAAAAGAAAACCAGAGACTTTGCAGCAGCCCCT
CATGCTGCTGCAAAAGGCTCAGCAGTCCAGTTTGTAAAGATGCGTAGTAGGAGGCTGCTT
TCCTGACACGGAGCCCCAGGGGCAGAGGGCAGGGGGAATGACCCAGAGAGACACAGCTAC
TCCTTTGGGTGACCTTGAGCAAGTTCAGGAAGGGCAGAAGAATAAACCAAGCCTGTGGGC
GGGTCAGTTAGCCCTTGCTGCATAACGATCCCCAGATGTAGTCCCTTCAGATGACCTGTA
GCGGGGCTTAGGATCCGAAGGGTGGATCTGCTTTCCTGAGCTGGGATCTATAGGGTTTGT
CAGCTGTGAGTCAGCAGATGACCTCCTCACTGATCTCAGTGGGGCTTCCTAGCAGGTCTG
GAGACAGCTGGAAAAGCCCAGCTGACTCATCCTATAGTAGCCTGCCTGGTCCAGAGATCC
CAGAGAGACAGGAGGCATGCCTCCTGGGGCCTCATCTTGGAACCAGAACACCTTCACTTC
TGCCACACTCTGTGGACAAAAGGGCCAGCGGGAAACACACACTCATGTCTTGATGGGAGG
GGCACCATCACAGCAGTGAGGACGTGTGCACAGGGAGGGGTGAAAAAAATGGGGCTACTT
CTGAGGACAGTCTACACAGAGAAAGAAAATAAGGATTTGGGGGAAGGGTGGGCAGAAAGG
GGTCTCTCTTCCTAGATGGGCTCTCTGGGCCCTGAGCTATGGATGGGGCATCTCCCAGAT
CAGAACTCCTGGCGTTCTGAGGAGCTGAGACAACACAGCAGGTGTTTGCTCCCTGTCTCC
CACTCCTAGAGAAGCCTTTGGTCAGACCCAGTGTGGCTCCCCAGAGCTAAGGCAGCCAGC
AAAGCTAAGGCAGCCAGCAGGACTCAGATCACCCTGGAGCAAAGACTCCCTCTCCAGAAC
ACACGGAGGCAGCAGAGGGTCAGGCTGAGGCTCCATGGGGAAGGAAGAGCAGCCCCCTCC
CTCGGAGTTGATCTTTCCAGAAAGCGGCCAGGGAGGGTCTTGAGGGTAATGGAAATGCCT
GTTCAGGCGGAAACTTAAAATTATGCAGCTGCTCCCAGTCCCTGAGTGGAGACCCCAAGT
CACTTGGGAACAGAGTTTGCCTTACTATCTTCTGAGTTACCTTAAGTTATATAAATGGAA
GTCAGGCCGGCAGGTCAAATATAGATATAGATATATAGATACAGTTTTTTGGTTTTTTGT
TTGTTTTGAGAAAGGGTGTA
Chart Advanced