SelenoDB
Release 2.0
Chart Advanced
Promoter Report for SPR00002303_2.0
Identity
PromoterGlutathione peroxidase (GPx)
SpeciesProcavia capensis (Hyrax)
Promoter IDSPR00002303
Promoter release2.0
External IDNone
Transcript SPT00002238_2.0
Annotation
Prediction method(s)
Promoter prediction (5000bp upstream, N/A) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox Forward Reverse  
Sequence
>SPR00002303_2.0 # Promoter # Glutathione peroxidase (GPx) # Hyrax 
CCGCCTGAAATATAATAAAACTAATCATAATGATGTAATGATAAAATAAGCAACAGTGTC
CAACATCTGTAAACTCTTTCAAAACAAAGACCTTTCATATAATAAGTTAGAACGCTTAAG
AATTTAAGAGGCCTCTTCAAGTAGTGTTTATAATCAGGTTCAAGCCACCACTAGAAATTA
CGTCTTCTGACTTTTTCTCTTCTTTCTTAGTGGAGGAGCAAGTGCTTCATGATGCTCTTC
CCACTTCTGGAAAATTAATACAACTCACCTGGTGTTAAATCCCCCCCCATATCCTTAATT
CCACCTCCAGTCACCCATCTCTTCTCAAATATTCTTAATAGACTTTTGTAAAGTTTATCA
AAATAGGAGTAAGCTCTTCATTGATTTCTCATTTATATGCTCTTCTATTGTAATTCCTTC
CCTCTGAGAGTCAGGCCCGTAACATGCTCCTACTCTTCATCTCACTGAATAGTCTTTCTG
GGGTTTTGTCACTGATGTACTCACGGTTAACAGTCCCCCTCTCCACATCCTTACATTGTA
GTTTGGAAGGATAGAGCAGTCTCCTCTACTACCAGTCACCTTATCACCCTTTGTTCTACT
GGAGCCTAGATGGACAACATTCCCTTCTTTGTCGCTTGGAGACACCTTGTCGAACCCAGT
GTCTTTTTCCAAAAGATAGTCTTCTCTCCTGTTGTGAGGAGAGACTCCTCACAAGTTGGA
AATTATATATTATAAAGCATAGGGAGGAAACTTCCTGTGGACAGGCAGATCGAGTCTAGA
ACTGAAGACCAAGCTCTTGTTATAAGAAGGGTTGGATTTAAATCAGACTTCCTGGAGATG
TTGAAAGAAGTCTTAGAATTTTAGGGAAATATAAATTGGGCCACTAGGGATCTTAGTCCA
TCAAGGTCTGCCTCATGCAGTGAAGGAATCTCCCATAGGTGAGCTTCTATGGTGAAAGTG
GGGTAAGGAGATCTTTTATTATCTATGAAGTCTGTAAATACTAACATCAGTACACTAGAC
AATCGCTGTTCCTTCACTGTCCTTGGCAAGAAGGAGGTTCCCCCTATGGAAAGTCCCTTT
CCAGAGTGCTCATCATGCAGTCATGCACACTTACACACACACACTTTAGTCTGCATATTT
GAGAGCATCAGACTATGGAACTCCCATTGAAGGGGTTGCCATCTATGTGCCTGCTTTCTC
CTTGCCGACTTTGCTGTGTGCTTAACAGTTCTTGCATTTGTCTTTCCTGTTACTGCAAAA
CTAAGTAGAATGCAGGGTCCCGGGGAAATTGTAGACTTAAAAAGAGTTCAATCCTTCCTT
TCTAGCTCTTGTATATTCTTCAATTTTGTTTCAGTTTGTTTAGGTCTGTTTGAAGAGGTC
AGGATGTCCTGACCTCTTTTCGTAAAATTCTACATCCAGAACTTCCACCTAATAAGGCAG
CAGTGACTGACACAGATCTAGAAATTCACTTTGGAGATGGTTTTTGTTTTTTTTTTATTT
CGAAGACAGGGAGTAATCTTACTACAGGTACCAGCTGTTGATTTTACCTGCATTATCTTA
ATCTTTACACTCACTAATCACAATGAAACTCAAACCCACTGCCGTCAAGCTGATTCTGAC
TCATGGACACAGTGGAACTGTCCCATAGAGTTTCCAAGAAGCACCTGGTGGATGCAAACT
ACCCATTTTTTGGTTAGCAGCCATAGCACTTAACCACTAGGCCACCAGGGTTTCTAACTC
AATAACAGAGGTACTCCAAAGTATGTTCTGAGGAGTAGACTTGGGAGCAGTGTTAGAAAT
GCATTCTTGGGCCCCACTCAGAGATTCTGGATCAGAACCACGCGGGTGGAGTCTAGAGAT
CTGTCCCATAGCAAGCTCTCTGCAGGATTCGTATACATGCTGAAGTCTGAGGCACTCTAT
TACATGATGGATGGGTGTGGTTCTCCATCTTTTATAAATGGGAGAAAGGAACCGACATAA
GATAAATTTTGAATGAATTTGTCTGGTTTTAAAATTAGCACTTTTTGTTGCCTCAGATCA
TCTCCTTGGGCCTTAACTCCCAACTCCACCCCGTAACCTCCCACACAGACACACATCTTT
TACCCCCTATACTGACATCCAGTATAGGGGGTTTCTGAAGAGCGCCCGCTAATTTGGGGC
AGAACGCAGACCTAAGAGCATATTCTCTTCGGATGGGAGCCTCACCTCCTCACCATAATC
ACCTCTTCTATGATTACAACCATCACTGCCGTGCTCAGAGCACATTCTTCTAGCAACATC
TCTTCTCCCTTCTCCTGGTTTCTGACTGAGCAGCCTTTCTCAGAGATCACGTCAAACTCC
TTCTCAGCCAGTTTGCTTTCACACCCCTCCCCATTTCCCTTAGACGCTTGGGGTCGCCCC
TTAGACAAGTTCGAGACCAGCTTAGAGGGCACTGGCTCTAGGCCATGAAGCGGCCCCCAG
GGGGAAACGGGAAGCGGGAATGCACGCTTTGTGCACGGTCCACGCGTCTCAACTAATCNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTATAGGTCGGTT
CTACTCTATCCTACAGGGTCCCTATGAGTTGGCCAATTAGAATGGAAGACAATGAGTTTT
TTATTTTTGCCATTTCTTTTTTCTCTTAGTCTGGGGACAACACTGCCACAAAATAATGGA
CATAGGGATTGAAGTTTAGAGTCAGGATCTTAGGTTTTCATCCCAGCTCTCATGGTGAGT
CACTGTGCCTACTTGGCAAACCAATTCTCTCTGAGCCTCAGTTCCCTCTGTTGATGGACA
CATTTGGACTACTCACTGGGTAATTACTAGGGTGTCTTTCAGCTCTAATAAAATATGTTT
TTATGGTGTCTTATGGGTCCACCAGAGGCAGGTTAGGTAAGAATACATTTTTTACCCTTG
CTACTCAGTGAACCACCAAAAAGAGCATCATTTGGAAGATTCTTGGAAATCTCAGGACCC
AATCCTAAGCCCTTAGACCGCAATGCACTCCTTAAACAAGCTCATCACGTGATTTATATG
CACACTAAAATACAAGAAACACTGCTCCCAAACAAACAAAACCTATTGTTGTTTAGTGGA
TGTCAACTCACAGCGACCCTACAGTATAGAATAGAACTGCCCCATAGGGTTTCCAAGGCT
GTAATCTTTATGAAAGCAGACTGCCACATCTGTCTTCTGACAAGCAGATGATGGGTTCAA
ACCTCTGAGGTTTCAGCTAGTAAGGAGGTGCTTAACCACTGCTCCACCAGGGCTTCTGTT
AGCATTCCCCTAAATGACTGTTTTTCTTTTGCTTCACGTCTTTAAACTCTTCATCTCTCA
GTAAATGAAACACTGTACCAAAAGCAAAAAAACTCCCCACTGTCTTCCAGTTGATTCTGA
ATCATAATGATGCTATGGACAGAGTAGAACTGCTCCAGAGAGTTTCCAAGGAGCACCTGG
TGGACTTGAACTGTCAGCCTTCTTGGTTAGTAGCCATAGCACTTAACCACTATACCACCA
GAGTTTCACCATATTGAAGCAACCAAAGCCACCATTATCAAGTCGATTCTGAGTAGTAAC
CCTATGGACAGAGTAGAACTGCCCCATAGAGTTTCCAAAGAGCACCTGGTGGATTTGAAC
TGCTGACTTTTTGGTTAGCAGACATAGCACTTAACCACTACAGTATTACACAGTACATTT
AATTATCAACATTAGCTGCGGGGGGCTTGAGTATTGCAGACAATTTGCTAAGTAGTCTGT
CCCCTGGAGAGGGGCTCAACATGCAAGAGTAGCAGGGATGGGAAAACACAGTGACAGTGG
AAAGTTTTCACAGAGAAAGCTGTAAACTGTTTTTCAGTGAACTAACTGCCCTGGGCTTAA
ATTTCATTCGTTGTAAATGGTAACTATTGTCTCTGTCTCACATACTCTATAAACCCACTA
TAAGATAACCATTGAGGTAGTGGGAAGTATTGGGACTGGCTAAAAGGCAAGGAATTTGTT
TCCCTGGCTACCTCCTTTCCCATTTTTCTCCCATCTGGCTTTGCCAGCTCAGCATTACAG
AACTCCTTGTTAATTGTAGTGATAGATTCTTTCCCTCTGCTTGCCCCGCCTCTTCCAGGT
TCACAAAAGGGCTGTTCCTCCTCCTGGGACTGAAGTCTGGATCAGGTTCAGTTTTTGTAA
ACTCTTATGCAAGAAAGAAGCTTTTCATTATTTTGGATTTCTGAGTTTTTTTCAGCGGCT
TCTAATCTACAGCCTGATCAGTAACACTTGATCCAGTCATGCAAGGCCCTAAGGCTTTTT
GGCAGTCAAGCCAAAGTCTTCCCTCTTTGGACACCAAAAAAAGAAAACAAAACCCAGTGA
CACTGAGTCAATTCTGATTCATAGTGACCCTATAGAACAGAGTAGAACTGCCCCCATAGA
GTTTCCACAGAGCAGGTGGTGGATTTGAACCACCAACCTTCTGGTTAGCAGGCATAGCAC
TTAACCACTAGGCCACCAGGGTTTCCTCTTTGGGAACCAACCTGCACATATTCCCAAACT
ATTCTGCCCTCCATTCCTTCTCAGTTAAACAAACAAACAAAAAAAGGCTGAACTTTAGAC
TATAAGGCTATAGACATGATTGAATTAATGATTCCGCGTGCCACCAACTGGATTCTGAAA
AGCTGTTGATTCTGTACCTC
Chart Advanced