SelenoDB
Release 2.0
Chart Advanced
Promoter Report for SPR00002215_2.0
Identity
PromoterIodothyronine deiodinase 3 (DIO3)
SpeciesPetromyzon marinus (Lamprey)
Promoter IDSPR00002215
Promoter release2.0
External IDNone
Transcript SPT00002150_2.0
Annotation
Prediction method(s)
Promoter prediction (5000bp upstream, N/A) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox Forward Reverse  
Sequence
>SPR00002215_2.0 # Promoter # Iodothyronine deiodinase 3 (DIO3) # Lamprey 
GCGGAGGTTCCATCGCGACAGTGCCACGCGCGTGTGCCGCGCTTTCTCGCACCCACCATC
GCGCCCCAGGTTTTATACGGCAGTGGCAGTCGGCTCTGGCACCCGGCCAGCCACTCCTGC
ATCCCCATCTGAAATCGCTCCCCCCCCGCCCCCCGCTCTACGGTCGCAAAAAAAAATTTC
TCATCCTTGTTGTGATCGGGAGTCGTTTCTTTGATTTCATTTTTGGCGGGGTGCGCATGC
CGATGCACGATCGTTACATAACGTGCCGCTGCGGTGGCGTGACTTTGCCCGCGAATTCCT
GAACTGTGAGAATGAGAAATAGAAAATATATTTTTATTTTTTACTGAGGGGGGTGGAGAG
GATTTACTGCAAAGGGAGACAGAATTATTTGAGTATGGTCCAATTTAAATGTACCCTGTG
ACTAGGGGCAAATGACACTCTCCCCAAATTCCACACGGTGCAAATTCCCAATGCCTTGTT
TCTGTGATGAGATACCATGCACGGGGGAGGGGGGGGGGTATGGTTAAATACTAGAGGGTC
TGCAGTTGCGATCAGGATTGGAGATAATTTTTATTTCGTGGTCACTTTGGTGGGGGGGAG
CGTTGGCGTGGAGGTTCGTGCACTGCTTCATGAACCCAGGAATCCGTGTTAAGATTCCCA
GCCACGGCTAACATCAGTGATGAGTGATATATGAACCGGTCCAGGGCCCCAATCAGCGTG
GTGAAGTATGGTCATACAACCCCCACGACTGACATGGTGTCAGAGGCCTTTATCTGGCAG
TGCATTAGTTGACATATAAAAATGTATTTGTCGGCTTTCACGACTAATATTATGATATTT
TTGTGGCGTGGCTTCTTCAAAGTAAAACTGCCGTGCTAATTCTGTGGGCACAATACTTTA
ACCCACCTTGTGTTTCCTTGGGCCAGGAAATGAATACGGTGCAATTAACTTGAGAAATGC
GCAATTCAGCGGTGCCTCGTGAGACGCGCGTACTTTCAATGAATGGGTCGTGATGCTCCT
GGGACACTTGGTGGCATCACACAAGGGCATCTACACTAAAGCATCGCAATTAAAGGAAAA
TAATATTTTAGGTGGCTTACCATACCAGTTCATGCCTCTGACAGGTGGCCACCAGTTCAT
TATGGTTTGGAAACCCTGACTTACGTGAGCTACGTGGTTGTGCTGAGCCGAGTGAAGTCA
CAAGAGGGCCCGGGCACTCCATCATCGCGAGCTCCGTCTCACTCAACGCAGCCGCTCTCT
CTCCACCTCCGCCCTCCTGATCACAATCAGAGACGGCGGAAATTTACGAACGAGCGCACC
CCAGGGCGCGATTTACCACCGACAATATTTCCCATGTCGCTGGTAGGCTAGCCTAAGTGG
CACACGACGAGAGGTGGCCGCGGCCGTAGTGAGAGAAATTACCCGACGTGGTGTACCGAC
TGTGTAAATATTTCCCGGGTCACAAGGCACAGACAGACCCGCCTGAAATGAATCCCTGAG
CGGGCGGTGTCCCAGGGGTGGGGATGTTCCATCCAGTGCCGGCGGAGAGTGGCCGTAAAT
CTCACAACGTTCATTTTCGCGCACGGGACGAACCGCCCACCGAGAGGTCAGCTCGGCTCA
AATCGCTGCAGTGACCCCGCGTCGCCGACAGAGAGTGTCGCGGTTCTAACGCAAGAGAGG
GGCGCTCGTAAATCTCAGCAGAGGAGGAGGAGGTTCATGTTCGCTCAGTAGGAGGGAGGG
GGTCACCGAAACCACTGCGGTGTAAACTACGACAGGGTTTGCCAAACTCCAGTCCTTGCG
ACCCGTCACCACCACGCTAATTATCTCTGCGGTTACCAATTTACTCCTCCCCATACTAAT
AGAAAATTGACTCGTTCCACCCTGCACATGCCCAATGATTGTTAAATGCGTCCCACGTGA
CGCACTAAGCAATTAACGCTGTCTGTGTCATGTGGAACACGCGTACACACACGTGACGTG
TACACACAAAGAGACCTCCATCTTAATTTGAATTGGCTCGATTCACACGGATAAAGTCCA
TTCAGATTGTTCACTCCATGCTTGTAATCAATGTGCGTTCAGAGTATTTGTCTGCTATAA
ATTTCTACGCGACAAGCCACTTCGTTGAGCTATCAATTTTCGCCAAGTCGCTCGTGAAAA
AGAGCTACATGGCTCAGTGAGCCTTACCTGTAAAAAATAAAGTTTTGTTTTAAGGAGAGG
CTCGCGTACCGCCACAGGGTGGCGGAGGGGCACGGCTTGAAAGCGCAGGCCACCAGGTGG
TGCCATTGCACAAGTCTGGTGAATATTGAGGGAACACATTTTGGACGATACACCCCCAGA
AACGAGAGAGCGCCAGCCCACCAGGACATTCACGCGTACAACAACGGGGCGGTTGTTCGC
GTCTATTTTAATTTTACCAGGTAAGGCCCACTGAACTGTACAGCTCTTTTTCAGAAGCGA
CCTGGCCCCAAATGAAAGTCAACGAAGTGGCTTATCATGCGCAAATTTGTAGCATCCAAA
TACTCTAAACGCATGTTTCTTAATGTGGAGGACCCCGGAGAAAAATCCACGCGACTGTGG
GGAGAACATGCACAATCCAAATATACAGGTGCCGGGGTCGGTATCGAACCCATAACCATC
CTTCATACTAGGCGAGGGAGTTAACGTCCGCGCCAGCGCAATGCCCCATATTGATTCAGC
GTAATGCCCTATATTGATTCAGCGTAATGCCCCATATTGATTCAGCGCAATGCCCCATAT
TAATTCAGTGCAATGCCCCATATTGATTCAGCGCAATGCCCCATATTGATTCAGCACAAT
GCCCCATATTGATTCAGCACCATGCCCCATATTGATTCAGCGCCATGCCCCATATTGATT
CAGCGCAATGCCCCATATTGATTCAGCGCAATGCCCCATATTGATTCAGCATAATGCCCC
ATATTGGTTCAGCGCCATGCCCCATATTGATTCAGCGCAATGCCCCATATTGATTCAACA
TAATGCCCCATATTGATTCAGCGTAATGCCCCATATTGATTCAGCACAATGCCCCATATT
GATTCTTAAGGACTGCTTGTTGTTGTGTTTAGTTTGTTGTCCTTCCCCCGCACCTCCAAT
TAGCACGGTTGGCTATGTACAGTGCGAAATAATAAAATACCATCTCTCACGGTCCTGGCA
TGTACTAAAAATCCATCTCGTGCCACGGCACGTGAGCTGATTTCCCTGCTCCATTGAGGC
GGTGGTCAGATCCTTAGGCGCGTTCCCTCCTTTGGCTGCCATCCCATCATTAGTCTCAAC
CATCGGCCAGGATGGCACTGGATAGCGTGCAGAGAAAAGAAGCAAAAAACATTCGGCCCC
ATAAAAAAAATCGCCCAGCCAAAAGAGATAATGAACGGACATCAGCGCGTGGTGACAAGC
GAGCCAGAGCTAGTAATTGTTAAACCAGGAAACGGTTCAATGATGGCAGGCGTCAGCTGT
CACTCTCAGCGTGAATGTTCCCCATACGATGAGAAAACAACTACTGTGCGAAAGAACAAG
ATGTACTTTCCGGGATTTATGTATTAATACATCCTGCCAGTTAATTGAATCCAGGGCAAT
GCGCCACTGTGGTTCTCGTCCAAGCTTCATTTGTCACTGCCGATCAGTGCTGTTTGCGAA
CTTGTAGTTATTTATTTATGTTTCTCCGGCAACATGCTGATCGCAAATTCTCATAGAGCT
GTACGTAGCCCTGTGTTCCACGGAATGAAATGTGGAAGGTGATATCACAGAAGCACATCT
GATCATTCTTCCTGGAACCTTTAGTCCACCCCAGGAGTGATGCACTTCTCCCACACCACG
AGGTTTAATTTTTTAATTAATACTTGGAGCTGGAATTTAGCCAAATGAAATGAAAAAACA
CATTTTTAGCAATTGGGATTTTCCGTGCGGTCACTGGCATCCAGGCAGAGACACTTTATT
TCTTCGATTTGAGAACCTCACCTGACCGGGAGCTGCACCTATGCTCTCACTCAGTGGTAA
AAGCTGAATGCTCAAACCAGCAAACAGATGGGCCCTGGAGCAAGGAGTGAAATTGGGCCC
ACCCCTGTCCAATTCCACCCCCCCCCTCTCCGACCTATGGGGCCCCGATGCAGTTGCACC
GCCTGCTCACTCAACAACCACGCCACCGCCCTGACCGCCGAGCAACCGGGCCACCTGCCC
CGTCTAGACGTTGCTCTAACGCTGCCGGGCGGCAGCTGAGCATCGGTGCCGATGGCGATC
GGAGCGGCGGGAGAGACGGAATCTCAACTGGGCTCTCTGTGCCCTCCGCTCTCGCGGAAT
GGCGGCGGTCGCGCAACCCGTGCACCGTCGCATCGCTCGGCTCGATCGCGCGAACTCATT
AACGCAACACAGCGGCGCGCCATTATCCCCAACGAGAGAGACTTGACCCCCTCTTAGTCG
CGTCTGAGTCACGCCGGCACCGCCCGCGGACCCCTCGAGCTGCTTCCTCGAGCAGCGCGC
AGGCCGGCGGTGATGCGACGATGTGTCTCCTGCACGTGCGTGCGTGTGTGCGTGTTCGCT
GTCCATGTGTACAATGTGAGTGTGTTTGCACATTGTGTATGTGTGTGTATGCTGTGTGTA
CGCTGTGTGTGCATGCTGCCTGTGCATGCAGTTTGTGCACGATGCGTGTGTATGCTGCGT
GTGTATGTTGCGTGTGCATGCAGTTTGTGCACGATGCGTGTGTATGCTGTGTGTGCATGT
TGCGTGTGCATGCTGTCCGTGCATGCTGTTCGAGTGCGAAAGTTTGTGTTCGTAAATCGC
CATTGCCATCCTGTGTCGTCCGACAGCTTACGGCTATTTTTTACACGTGAGATACATGCA
CGAGTGAATTTGACGTGGTCGCCTTTCAGTGTGCATTAGCTTTATGTAGGCCACTCGGCT
TTCCATAATTGTAATATTATTGCTTTAAAATGCCCTTTATCACCGAGTTTCAATGCCTCT
CTTAATTTTCAACGAGTCCT
Chart Advanced