SelenoDB
Release 2.0
Chart Advanced
Promoter Report for SPR00001113_2.0
Identity
PromoterMethionine-R-sufoxide reductase 1 (MSRB1)
SpeciesGallus gallus (Chicken)
Promoter IDSPR00001113
Promoter release2.0
External IDNone
Transcript SPT00001048_2.0
Annotation
Prediction method(s)
Promoter prediction (5000bp upstream, N/A) [Report annotation error]
OrientationReverse
Structure gene structure

FeatureCol PromoterCol Coding exonCol Non coding exon (UTR)Col IntronCol SECIS
ResidueCol SecCol Cys or Other

Toolbox Forward Reverse  
Sequence
>SPR00001113_2.0 # Promoter # Methionine-R-sufoxide reductase 1 (MSRB1) # Chicken 
TGGCTGCGTCCGCCGCCGACCGGCCCCGCCCCGGTACCGCCCCCGGTACCCGCACCGCCT
CCGGTACCGGCACGGCCCCGCGGCCACGAGGTGGCGCCGTGACGCAGCCGCCGCGGAGCC
CCGGGGGGGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCCCCTCCCGCTCCTTTCCCCACAGCCCCG
GGGGCGGCTGATTCGAAGGAGCCGTGCAGGACCGGCCCCGGGGCGGAGCTCGGCGGGGCG
GAGCGGGGCCCGGCGCGGTCCTGCGGATGCTCCGACACCGGTGGCTGGAAAGCGGAGAGC
CGCAGCCCGGCACTGGCTATCCCAACCCCGTACTGAGACCAGGAGCGGGTCCGACCGCTC
ATCTCCAGCACCGGCTCCGGCCCGGACCTTCCCTGCCCGTCATCGGCGTTAGCCCTTGGA
TACCGGCACCGGCTCTTCTTCACCGGCACAGGATCCTGTCCTCCTCCAGCACCGGGACTG
TCCCACACTTGCCCTTTCCCCAGGCATCGTTCTCCACGGCAGCACCGGAACCGCTCGTCC
TTCCCCGGAACCGGGACCGACCCATCCCGGCGGCCCCGGGCGCTACCGTCCGGGCAGGTA
CGGGAGTGCAGAGCGGTGCTGGAGGCTGCGCAGCCCCTGGGGGGCTCAGCGAGATGTCTG
GGGAGGGCGTGGGGCAGAGCGTGTTGGGGGGAGGGAAGGGGAGAGGCACCCGTGGAGATC
CCTGTGTGCTGCCAGAGGGGTGCACGGCCAGCAGTGCGTGGTCGGGCTGCAGGCGCCACG
GGACAGAAGCTGTGGGTCGCTATGGGGTGCGGGCTCAGCAGGGGTTGTGGTCCTTCCTGC
CGCTTCAGCAAGGGCACAGCAGAGCTCCAGACGCTGTGGGGACCGTCCCTGCTGTGCAAG
GGTCGCTGGAGGACGGTGTGGGGCTGAGCAGAGCTCAGGGCTCCTGGGGAAGGAGGTGGC
AGCAGCCCGGTGTGCTGCAAGGGAGCAGCTCTGCTGTGAAGGTGAACTGCAGGCTCTGGG
AGGCGACGAGCTGTGCGTCGCTTCCTTTTCCCTCTGAAATACCTGGCACTGCGAGCTGCT
GGCTGTGTCTGAGTATTACTGGATGATTCAGTCCACGGGCTCGAATTCCACCACANNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTACTGGATGATTCAGTCCACGGGCT
CTCACTGAGATCACACTTCCTTGCTGCAAGAGCAAAAAAGCCAGGGCCTCTGGGACAAGT
GCAGGTGACCGTCCCAGGGAGCCGCTGCTGCTGGAGCCCCGAGGCCTGGGATGAAGCACT
CTGATGGGCTTTGGTCCTTAATGACAACGGACACGGCCACATCTCTCAGTCAGGAGCAGA
GCCGGGGGGGCCGTCATGAGCAGACCCCAGCACTCCTGCCCTCTGGATGCTGCCGTTTCA
AATTAGGTCAGGCGTGCGTCTCAGGCTCAGGCACGCTCCGCTCGAGCCCCAGGGATTGAT
GGTTTGTGGCAGGCACGGGGCAGGGCTGGGGGAGCCGAGGACTTACGGTGTGGCTGCGTG
GTTTGGAAGGTGCCTCCTTTGTAATTCACTGACAGCAAAGGAGAGGGAGGGGCAGGGAGG
GCACCAAACACACCGAAGCACTGCATGCTCCTCTGGGCACAGGTTTCCAGCCAGCATAAG
CCAGAAAGTCTCTGGTTCGGCAGCATCACTTGTCCAGCCCATCTTGTGCTAACTGGAGGC
TTGTCAGGAGGGGGATCCGTGCCTGTGCTCAAAGCTCTCTGGTTTTGCTGAGAAGCAGTC
TGCACTTGTCAGATTTATGTCCCTAGGCTGCAGTGTGACTTCCATCAAAGTCCTTAATCA
TGGGATAATGTGAGGAGCTCTCCAGTTACAGCGCTAATAGCCACGGCAGTTTGGTTCCTG
CAGCGGTATATTGTGGAGATAATTAGAGGAGGGATTTCCAACTTGTTTGGCTGCCTGATA
AAAGCCTCAGAGATGAGGCAGAGCTCTGCCACCACCCCGTGAGCAGTGCCAGCCCTCCTC
CAGCGAGTGGCCATCGGCAGCTCTCATTAACGGGAGAGGGCTGCTGGAAATTAATTTGTC
AATTAACTCTCCTCGATTTTACAACAGAAGCAAACATTACTTTGGCAGTGGCCCGCCTGG
GAGGGCGTGGGTGTCATTTGTTGGCGTGAGCCAATGCTGAGCAGTGAAGCACAGCAAAAG
TGCTTAGTGCTGTGTGTGTCAGGGGAGCATTTTGGGGGGAGATGCTCAAAGGCACCAGGC
AGGCATAGGTTGCAGCTCGTGTTTCTTTGCACCAGATTGGCTCACAGCCTTACATCTGAA
GCAGCAACAGACAGAAATTAGAAGGATGGCTCTGACTGAGAGGCTTTCTGACCTTTGTAG
CCGTGGTCCAGTGGCACATGCTCCAAGCAAAGCAAATGTCCTGTCCTCTTTGGATAGGAC
ATCCCATGCAGCACCATTGCAGGCTGCTGATGGCTCAGCCTGGCAGCTGCAGGTTCCATC
CCCACTGCTCCACACAGTCCTGGCCTCCCCCGCACCCCAGAGGTGGCTGCACTGCAGTGT
GCATAGCCCCCGCTGTACTTGATGTCCCTGCCAGATGAAAACTCCCATATAAACCCAGGC
TATTATTATCTCAGTCTTCCACTGTGCTAATGGTCTCTCAGGAAACAGTCATTTTCTTTT
CCATTTTCTTTTTTAAGCTTTCTAAAACCCCAGGAATTCTGGAGAGGTGGTAACCATAGC
AGAGCTGGGGTGCCCCTGACCCGGCACAGGGAGCAGCAGCAAGCAGCTCCCCCTGAGCAT
TGGGGATTTCTGGTAGGCATGGCTGAGGGCTGAGGAGGGCTGTGGGTGGCGCTGGGGGCA
GCTGTGACACTGGGGACAGTGTGGCACTGAACCACCAAGCTGGTGCTGCAGGCTGGATGG
CATAGGGCTCTGCCTGGTGCTGGGTTTGCTGTGTAAATGTGAGGAGAGCACTCTTGGCAC
TGGGCAGATCCTTCTGGAGTATGGCAGCAGAGCAGGGACGAATCTTGCACTGGATCCCGT
GGGCTGCCAGCTCCAGAAGCTGCAGTGTGCTCTCCCTGAGCATCCCCCATGATTATTTGG
GGTTAACAGTTGGCTCATGTAAATGAGGAGCAAAGTGAAAGCCACGAAGCATGAGATTAT
ATAAATGGAGCTGGAGGCAGCTGCGACGCAGCCTGTAATTAATTCATGGTAGGAAAGTGC
TTTGAAGATCTCAACGAAGCAGATCCCAGGCACGAGGCAGCCTCAGGCTCATCCCTGCTC
CTGTTGTGGGGATGCTGCAATGGGAGGGGTAGCGGTGGAGGTCAAGCACCCCAATGAGCC
CGCTGACAGTGGCAGCCCCGTGTCCCCAGAGGCATCCCGAACTAGGTTCAGAGGCATCCA
GACCGTGGCAGCCTTGGGTCCTTGGGCAGGATGTGCTGTGCCTCGATGTGGCACCGAGCT
GAGCTGCTCTCTCCTCTTCCCTCGGCAGCACCGCCGGCGATGCGAGCGATGGCAGACCAG
GCTGCAGTGGCGGCGGAGGCCTCTCCAACCCTGGCACCATCCCCGGGCTCTCCTCGACAC
AGGGACATCAATGGAACAAAGTCTCATCCCGCCAGCACCAGGGAGAATGGCAGTGGCAGG
GAGGGCAGCGGGACCCTATTCCCCATGGAGGGAGACACGAAGCCTCTCTCCATGCTCCTG
GCTGACGTCCCACAGGGCCCCCAACAGCGGCTGGGCCCATCCAAGTCCCGCACAGCCCCA
TCCTCCCCCAGTGTGTCCCCATCGGAGAGCCGTGCCGCGCTGCTCCGGCTGCGGGAGGCC
AGGCTGGAGGACGCCAGGAGGCGGCTGTCGGAGGCCGTGCAGGAGCCCCTCAGCCATCTG
AGCCGCCTGATGGCCGAGGAAAGTGGCCCTGCAGGCCGGGCAAAGGGAGGGTGCAGCCCG
GGGCGAGGGGAATCAGGGGGCAGAGGGGACGGGGGGCAGCGGGTGCGGGACTGGAGCCCC
TGGGAACCCACCCTGAACTG
Chart Advanced